Genomic Feature

th241

ID
ZDB-ALT-980203-363
Name
th241
Synonyms
  • AH41C (1)
  • th241c
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 13: 25449886 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Leu>Pro at position 44 (1)
Sequences
Flanking Sequence
GCATGCACTTTTTAATTAGGTAATGGTCCTTGCCACCCGGCGCTGGTTGTGGCCAGATGGTAAGTTATCTCTGGTTTGTAACGCCTGTTTTCAGTGATAGAGCAGCCAAAGTTAATTGGAATGTCATTAAAGTTTGAGTTACTGGGGGTTGGGGCTGGACTGCACTAGTCCTGCTGTTGGAGATGTGCGTTTCATTAATAATAATGGATGTTTGGATGGAGTAATAAGGGTGGGGCTCCACCTGCTGCCACCTGTTAATACTCTATATAAGCATCGCTCATCCTTATGGCAGAACAGAAGCGATTAAGAACCATCCGGAATTACATCCCAAGAACATCGGTGACATTTTTGGAGACTTTTTTGAAGAGCCATGAAGCCCCGCAGGCCGAGCTGTGCAGACTCCGGGTCTGATTCTGATTCCAGAGACCCGGAGAAGTTTGAGAGTGCTATGCGGCGCAGGATGGCGGCCAATGCAAGAGAACGAAAGAGAATGCAAGGCC
T/C GAACACGGCATTCGACCGGCTTCGGAAAGTGGTTCCACAGTGGGGTCAAGACAAGAAGCTGTCCAAATACGAGACCCTACAGATGGCTCTGAGCTACATCATGGCCCTCAATCGGATCCTGAGCGACGCTGGTAGACACGTGGATCCTCAGAAAGACTGGCTTAATTTACAGTTCGACGGCCTACAGACTGAGGGATATTTTATGCACTACGATTCACCTGTGGAAAGTGACTGCATGCTTTCTTCTTTCTCCTACCACTACGAAAGCCTCTGAAGTGACTGACTGATGGAGCATTTACTGTATCTTTCTTTATGTGGATACAGGAGGGTGTAAATATGTTTGTATTACTATGTAATATTTTATGTTCATGCTTTAATGGAGTCTGAATCATTCTAGTGGTATACAGGGTGAGGAAAAAGTACGTTTTTGTGCAATTGTAGAAAATCTTCCATTGGGCGGGTTGTGAATGAGGACTTAAAAGCGCATTTGTTTATGAATC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations