Genomic Feature

ta98

ID
ZDB-ALT-980203-1630
Name
ta98
Synonyms
  • A98A (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 4: 8662547 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C at position 968 (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Cys>Arg at position 323 (1)
Sequences
Flanking Sequence
GCTTGCTTTTTACAACTACACCATCAGTATATTTCACCAGTCATATAAAAACTCACTCTGGACAATGAAAGTTTTAGTGCATGTTTGGAATCCCTGTTATGTGTGTATTCTTTGGTTCACTGCTCATTGAAATAACTACCCTCAATCTCTCTCCCTCTCTCTTAAAGGCGGTGTATAATCTAGCGAATGTGGCCTGCAAGTGTCATGGCGTCTCAGGCTCGTGCAGCTTGAAAACCTGCTGGCTCCAGCTGGCCGACTTCCGGCGTGTTGGAGAATTCCTGAAGGAGAAATACGACAGCGCCGCCGCCATGCGCATTAACCGACGTGGAAAACTAGAGCTGGTCAATAATCGATTCAACCCACCGACAGGTGAAGATCTGGTCTACATCGACCCCAGCCCGGATTACTGCCTGCGCAATGAAACCACTGGGTCTCTGGGCACCCAAGGCCGCCTATGCAACAAGACCTCGGAGGGTATGGACGGCTGCGAGCTCATGTGC
T/C GCGGCCGCGGGTACGACCAGTTCAAGACCTACAAACATGAGCGCTGCCACTGCAAGTTCCACTGGTGCTGCTATGTCAAGTGCAAACGCTGCACGTCACTCGTAGACCAGTTTGTGTGCAAGTAGCAGACGTGAGAACTGGGGGACAGACGCACTGAGCAATTAAGCAGGAGAAGAAACGGGACCCTTAACGGACCCAGAGGGGCAACTTAGAGATAATTAAATGTAAAAATGATATATTAAATAGCAACAAATTAAAATAAGTATATAAATAAGTGTACGTGTGCCGTTGATAGTAATTTAATGACCTGAGGATCCACGTTGGACGTCATTGATGAAAAAGGAGGCACCGGTGTGATGCATTCCGGCTCAAGCTGTGTTTCTCTCATAAAGAGAGGAAGGAACTCTTGACTTGTGCTACAAGAAACTCTTTAGAGACTCGAGGAAAAGGCGCAGAAATAGGATGGGGAACATCAAGGGCGCATCACCCACCCATTGCCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations