Genomic Feature

dti216c

ID
ZDB-ALT-980203-1618
Name
dti216c
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 14: 26472039 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Thr>Ile at position 299 (1)
Sequences
Flanking Sequence
CTACTGTTCTATTTACACTTTTCAAAAAGTGGATTAAAAACTTCCGGTGGGTTAAAGTCCGCAATGAAAATGACTAAATCCATTCTCCCTAAAGCAGGTGTATGCAAATGATGTATGCAAATAAATGAGTTATATGTTAATATCATCTGTGCAATATCAGACACCACAGTTAGGGCTGGTGGGAGAATGCAGATGTTTTTGGCTGGTACGCCTACATTTTTAAAGTTAAGAACACCTGTGCAACCAAGAAAAAAAGGTTAATTTCGAGCCCTGATGAAGATAGTCTTTAGTTAATCGCCCAGCACTAATGTTCACTACAACAAAAAGTCACTTTCCACTAGATTTCAATCCCAGAAATAAGTGAAAAAGCACAGTAGTGGTGCATAATAACTACACACATACCTTTGCCGATGTGGCGACGGGTGTTTTCAATAGTGGAGTTGCGATTGACATTAGAGAGCAGGCCCAGGCAGAAGCGATTTTTGTTGTTGGATGGATCG
G/A TGAATCCATCAACCAGTACGCTGGTGGAGGAAGCGTGGTAAGCCTCTCCCACACGATTATTCAGCTCATAGTACACAATAGAGCACCAGTGACTGGGCTCCTGATACTCCACTGGCTGCACATCTGAAAGAGGAAAATAAAACAAGACCTTGAGCTGTAGCCATCTATTGTTTCAACTCGCGCAGACACTTCAGCACATCAGCTAGATAAACATTCTGAAGAGATTACAGGAGGATCCTGTGCCAAAGGCACTTTAAGATTACAGCAAGCAAATGGTGTTAGCGATACAGGTCGCCTGAGTCATGATGACTCTGATATTTAACTATAGATGTTGTTGGTGTGATTTTCTATATTAGACAGGACGAAGTTTCCAAGATTGTTTTATTACGCTGTCACAAAACAAAGGTGTATTTCCAATGTACCAGGCTGCTGCAATAAGTGCTTTTGAGAGGGAACTAGTCATTTGCTAATCCTCCCTGAAATGTAATGTATAGAAAGTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
dti216c.pdf
Citations