Genomic Feature
te314a
- ID
- ZDB-ALT-980203-1526
- Name
- te314a
- Synonyms
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one point mutation (1)
- Protocol
- adult males treated with ENU
- Lab of Origin
- Nüsslein-Volhard Lab
- Current Source
-
Zebrafish International Resource Center (ZIRC)
(
order this
)
European Zebrafish Resource Center (EZRC) ( order this ) - Other Pages
Notes
No data available
Variants
- Variant Type
- Point Mutation
- Variant Location
- Chr 12: 3921103 (GRCz11) (1) Details
- Nucleotide change
- C/T
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- C>T at position 1030 (1)
- Transcript Consequence
- Premature Stop (1)
- Protein Consequence
- Polypeptide Truncation: Gln>Stop at position 344 (1)
- Flanking Sequence
-
GAGAACATAACATAATTTTTCTGTTGTTTACCCTAGGCAAAGAGAGGCAAGGCTGAAGAGGAAAATTACATCCAGCCAAGAGGAATGTTTGGATATTGGTGAGGATTATAATTATTTACTTCAGAATGTACAATCTCATAAATTCAAATCCAATTAAAAAGTAAATGCAAAGACTTTACTGATATTTGTTCTAGTCTTCACAAAAGAGTACTTTAGTAAATATGGGCTTGCTAATTTTCCATTCTTTCTTACGAAACAATTTTTCTTGCTTCCCTCTCTCAGAGTCATGTGACCCATGTGATTCCACGGAGCTCCTCCCACAATCTGTGGATCTCCCAAGCTCCGCCCTCACCATTATGAACACCGCCCTTCCAATTACAGACTCTGGTTTTCATACAGAAGTGTCATCTCACCCAGATCAGACAGACTCTGACCAAACTCTTGTCCTTGAACAAGCCTTCTTGACCTCTGAGATGCCCTCTTCAATGGAGAGTCAACAA
C/T AGACAACCTCTGAAACTAACGTAAACAACGCACTGATGGATGAGTAAGTGCTATAACCTCATAGCTAAATTAAGAGTACACTTTGAGACAACATTATCAATGATTTTTATCTGTCTTTCTATTATAGAACCGGTCAAATGATGGACCTTTCTGGATACACATCATCTTTCCCAACTCCTCAGCTCAGCTCGCATACATCAGTGCCTCAGTCTTCTTCAATGTATTCTGTGGTGTCCTCAACGCAGAGCTCAGACCTTGAGCTTCCACAGGCCTCAAGTATTTCATCTCCACACTCTATGCCTGCATATTCCTCTATACCTTCAGCAGAGTATCCTGGCGTAAATTCCTCTACAGCTATGCCTGCATCTACAACCTCTCTCTCAGACTCATACCCTTCTATCTCACACTCCACCTCTTCACACCTTCTCCAATCTTCATCCTACCATTCTCTTCTTCCAACAGACCAATCCCAAGACAACCTAAGCCCCCATACACCTACA - Additional Sequence
- None
Fish
Fish | Genomic Feature Zygosity | Parental Zygosity | Affected Genomic Regions | Phenotype | Gene Expression |
---|---|---|---|---|---|
tbx6te314a/te314a | Homozygous | ♀-/- ♂-/- | Fig. 5 ![]() | Fig. 5 ![]() | |
tbx6te314a/te314a | Homozygous | ♀+/- ♂+/- | 5 figures ![]() | 6 figures ![]() | |
tbx6te314a/te314a | Homozygous | Unknown | 8 figures ![]() | 8 figures ![]() | |
tbx6te314a/+ (AB) | Heterozygous | Unknown | |||
tbx6te314a/te314a; v8Tg | Complex | Fig. 6 ![]() | Fig. 5 ![]() | ||
tbx6te314a/te314a; zf605Tg | Complex | Fig. 2 ![]() | Fig. 4 ![]() | ||
tbx6te314a/te314a; tbx16lz34/z34 | Complex | Fig. 4 ![]() |
1 - 7 of 7
Show
Supplemental Information
- Genotyping protocol
- None
- Nittoli, V., Fortunato, A.E., Fasano, G., Coppola, U., Gentile, A., Maiella, S., Langellotto, F., Porreca, I., De Paolo, R., Marino, R., Fiengo, M., Donizetti, A., Aniello, F., Kondo, T., Ristoratore, F., Canzoniero, L.M.T., Duboule, D., Wilson, S.W., Sordino, P. (2019) Characterization of paralogous uncx transcription factor encoding genes in zebrafish. Gene X. 2:100011
- Morrow, Z.T., Maxwell, A.M., Hoshijima, K., Talbot, J.C., Grunwald, D.J., Amacher, S.L. (2017) tbx6l and tbx16 are redundantly required for posterior paraxial mesoderm formation during zebrafish embryogenesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 246(10):759-769
- Windner, S.E., Doris, R.A., Ferguson, C.M., Nelson, A.C., Valentin, G., Tan, H., Oates, A.C., Wardle, F.C., Devoto, S.H. (2015) Tbx6, Mesp-b and Ripply1 regulate the onset of skeletal myogenesis in zebrafish. Development (Cambridge, England). 142(6):1159-68
- Blaker-Lee, A., Gupta, S., McCammon, J.M., De Rienzo, G., and Sive, H. (2012) Zebrafish homologs of 16p11.2, a genomic region associated with brain disorders, are active during brain development, and include two deletion dosage sensor genes. Disease models & mechanisms. 5(6):834-851
- Cutty, S.J., Fior, R., Henriques, P.M., Saude, L., and Wardle, F.C. (2012) Identification and expression analysis of two novel members of the Mesp family in zebrafish. The International journal of developmental biology. 56(4):285-294
- Windner, S.E., Bird, N.C., Patterson, S.E., Doris, R.A., and Devoto, S.H. (2012) Fss/Tbx6 is required for central dermomyotome cell fate in zebrafish. Biology Open. 1(8):806-814
- Jülich, D., Mould, A.P., Koper, E., and Holley, S.A. (2009) Control of extracellular matrix assembly along tissue boundaries via Integrin and Eph/Ephrin signaling. Development (Cambridge, England). 136(17):2913-2921
- Mann, C.J., Osborn, D.P., and Hughes, S.M. (2007) Vestigial-like-2b (VITO-1b) and Tead-3a (Tef-5a) expression in zebrafish skeletal muscle, brain and notochord. Gene expression patterns : GEP. 7(8):827-836
- Mara, A., Schroeder, J., Chalouni, C., and Holley, S.A. (2007) Priming, initiation and synchronization of the segmentation clock by deltaD and deltaC. Nature cell biology. 9(5):523-530
- Shankaran, S.S., Sieger, D., Schroter, C., Czepe, C., Pauly, M.C., Laplante, M.A., Becker, T.S., Oates, A.C., and Gajewski, M. (2007) Completing the set of h/E(spl) cyclic genes in zebrafish: her12 and her15 reveal novel modes of expression and contribute to the segmentation clock. Developmental Biology. 304(2):615-632
1 - 10 of 23
Show