Genomic Feature

ta52b

ID
ZDB-ALT-980203-1374
Name
ta52b
Synonyms
  • A52B (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 2: 4159765 (GRCz11) (1) Details
Nucleotide change
T/G
Variant Notes
Itoh, et al. (2003) showed that mibta52b mutants have a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Met>Arg at position 1013 (1)
Sequences
Flanking Sequence
GCTAGCTTTCATTTTGATTGAATTATTCTCTAATCGGTTGCCTATTATGTAGTGAATATACCCCTGTACTGCACACTGCAGTCCTTTTTTTGTCTGGCTTTCTCGGATATCTCACCTGTTCGCCAAAAATGACATTATATCCCTGGCGATGTCTGAAACCGGCGCACACACATTGAAAAAGCCGTGCCAGGCACGAAAGCTTGACAGGCGTAGCAACAGTAACTAAGGAGGGCGGGGCTTAGCGAAGGGTCCACTGCTGTAAGATAGTGTTAGATTTAGCTGAAAGTGATGCAGTTTAAACAGTGAATTGAATCTATTTACCGTCTGTCTACCCACAGATTTGCACCTCTAGATCTTCAGGATGTTTTGTTTTATTGCCGTTATGGCTCATTGAACATGTTTCTCTTCCTCTCAGACTATGTGCCCGGTGTGTCTGGATCGTCTGAAGAACATGATCTTCATGTGTGGCCACGGCACCTGTCAGCTGTGTGGAGACCGCA
T/G GAGCGAGTGCCCGATCTGCCGCAAGGCCATCGAGCGCCGAATCCTGCTTTACTAGAGCGCCGCGTCTGTGTGGTTCTCATAAGCACCTTCCCCGGATCTGCAAGGCTCTCCTTGTCTCACGCTAAGCTAAGAGTCATCAGTGTTACCACATCCATCTTTGGTTTCATCTTCAATATTAACGTTTTAATTATGTTCGAGGAGACAGAAACTCGTCTAATGACTGTATTTTTCATACAAGTGCCCGCTTTTTGTTTTCAGCAGCGCCGACATGAACTGACTCTGTCAGGGTGTGCTAATCATTCATCTACGTCAGTGTATTATGCTTATATATCCTGATGCAAAACAGTTGTATCTACAGTATCCGTGTAGAGCATGGTGAAGTTTAGGACGTGACCAAACTCCCACACTTTTTTTTTTTTTGGAGATTTCTCATTTTGTGTGACGTAGCGTTCAATCGTTTGTCCGAAAGGCGTCCATCTTTTAGCAGTGTACTGTTAGTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
ta52b.pdf
Citations