Genomic Feature

tf216b

ID
ZDB-ALT-980203-1332
Name
tf216b
Synonyms
  • AF16B (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 19: 3380056 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
In suc (sucker) mutants, an A-to-T transversion results in an Asp8-to-Val8  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>T (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Asp>Val at position 8 (1)
Sequences
Flanking Sequence
TTGGACTAGAAACAAGACCAATAATCGAAGTAAGTGTATCCTCGAGAATATCCAAACACTGAGCTGCTCTACTCTTAACAAGCAAGCCTTGTGTCCTTGAAAGTGGACTCAAGATCAAAACTATCTGCTTGTAAGTATGATGAGGCGTACTCACTGTAACGCACTGTCCGCTTGGCAGAATGAAGAGCATGTTTTGTCTTGACTATCTGCACATTTGCAGCGTGACTCGAGCACAACAGGTTCTGTGACCGAGCGCTTCTTGCGTGGAGCGTTTCCAAGTCCATATGACACCGTTCGCCTGGAGGAAAGAAAAAATGATTAGAAAACAATGTTAGTCATGCTAAAAAAAAAATAGCATGATGGACAGATCAATCTCTAACGATTTACAGTTCATAACTGATGGTATTTGCATGCATTTTTGATATATAATGTCTGTTCTGACTTACTCTGGTGTGTTCACCCATATTATGTCCAGGTGGCAAAAGTAGACGCACTCTTTA
T/A CCAGAAAACTTGCGCAGGAGCATCTCTTATTCCTGGAGTGACGTGCTGGTGCTGTGCCTGGACCCAAAGATGCTGGAGCACCTAATTAATCATAAAGGTACATTCAATTTATTAGCTTTTCTACATATTAAAAACACTTTGCATGATTGACTAGAGATGATTGAATTTGTCGCGCTTAATTAAAAATGACATTGATGCACAATTCATAGTCTAAAAGAATAGTAAAGGTTTATCTTCAATGTGTTTGGAGCTTGTTTTTATAAAGAGCTTACTGAGATATTACACTTTTTATGTTTGTATCTTGACATATTGCAGTTTTTAAGACTTATGTAGACTTTAAAACTAATTATGAGGCTGTTTAAACCATATTACCACAATATATAGATACATATTATAGATTTACATAGATATTAAGTATTGAGGAAACTATTTATAAAGCTGTTTATATCATATAACCACAATATATAGATACATAATAAAGATATGGAGTGTTAAGGAAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations