ZFIN ID: ZDB-ALT-980203-1303
Genomic Feature: tc300b
Synonyms: AC100B (1)
Affected Genomic Regions: tnnt2a
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 23: 5682807 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>G in Acceptor Splice Site of Exon 3 (1)
Transcript Consequence: Splice Site, Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TATATTTTTCTTCTGATTTCTACAGGCGCACATTCCATCTGGGCCTAAATGATATGCTAATCATGTTTAAAAATTAGCATTAAACCACATATGTAGTTTAGTTTAACATTTTGCCCCTTTATCTGACTTTTGTTGAGCTTTGTAGTAAACTTTGGTATTATTTTTACCACAAAACCTTCACTAACTAAAACCCTGATCCAAATAGTTTAAGAATATGTGTGATTTTATTTTAAAATTCAGTAGCTTCTATGTTTACAAGGTGTTATTCTCTTAGCTCATGTTTCTCTTATTAAAAACATGGTACATTTTAGCCTACAAACACCATCATCACTATATAGCCAATTTGCTGCTCCACTTCTCAATCTAACACATTAAAAGTCCCGCAAATTAGCCGCAAGGTCAATATTTATGACCTACTTTAAACAAAACCAGCATTATCTTGTTTATAGTGCATGTATGAAAGTAATATTATGGAACATAAGACTTACCCTCCTGCTCCC
T/C
AGAGAAGAAGACAGAATAGAGCTGTTATTTCCATTGTTCTCATAGCTCAAGTACTTTCCTGACAGCTGTGTGAACTCTCAGATTAAACAGACTTATCAGATGAGTGACATATGGTATTAAAATAACCTATAGCTCTTATGACTGCGACATACACATAATGCAATATATTCATACATGTCTCTGGTTAGGATGTAGATGTAATATCTCTGGGTAAAAAAAGCTGATAATAATATATTGTTACAGACAAATTCATAAAGGCCATATTATCACTAATGAAGGGGTGATAACTAAATGAGAAAAACACTTACTCGTACTCTTCCACTTCTTCGTTGTCTGACATGTTTGCTCTGTCCAAAAAAAAAAACAAAAAAAAACAAACAACATAAATTTAAGGATTGTTATATATTATATTATGGCGACGCAGTGGCGCAGTAGGTAGTGCTGTCACCTCACAGCAAGAAGGTCGCTGGTTCAAGCCTCGACTGGGTCAGCTGGCATTT
(1)
OTHER tc300b PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous tnnt2atc300b/tc300b tnnt2a ♀+/- ♂+/-
Complex tnnt2atc300b/tc300b ; y7Tg tnnt2a
ubs3Tg ; tnnt2atc300b/tc300b ; zf350Tg tnnt2a
Unknown tnnt2atc300b tnnt2a Unknown

CITATIONS  (24)