Genomic Feature

tc300b

ID
ZDB-ALT-980203-1303
Name
tc300b
Synonyms
  • AC100B (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 23: 5682807 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>G in Acceptor Splice Site of Exon 3 (1)
Transcript Consequence
Splice Site, Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TATATTTTTCTTCTGATTTCTACAGGCGCACATTCCATCTGGGCCTAAATGATATGCTAATCATGTTTAAAAATTAGCATTAAACCACATATGTAGTTTAGTTTAACATTTTGCCCCTTTATCTGACTTTTGTTGAGCTTTGTAGTAAACTTTGGTATTATTTTTACCACAAAACCTTCACTAACTAAAACCCTGATCCAAATAGTTTAAGAATATGTGTGATTTTATTTTAAAATTCAGTAGCTTCTATGTTTACAAGGTGTTATTCTCTTAGCTCATGTTTCTCTTATTAAAAACATGGTACATTTTAGCCTACAAACACCATCATCACTATATAGCCAATTTGCTGCTCCACTTCTCAATCTAACACATTAAAAGTCCCGCAAATTAGCCGCAAGGTCAATATTTATGACCTACTTTAAACAAAACCAGCATTATCTTGTTTATAGTGCATGTATGAAAGTAATATTATGGAACATAAGACTTACCCTCCTGCTCCC
T/C AGAGAAGAAGACAGAATAGAGCTGTTATTTCCATTGTTCTCATAGCTCAAGTACTTTCCTGACAGCTGTGTGAACTCTCAGATTAAACAGACTTATCAGATGAGTGACATATGGTATTAAAATAACCTATAGCTCTTATGACTGCGACATACACATAATGCAATATATTCATACATGTCTCTGGTTAGGATGTAGATGTAATATCTCTGGGTAAAAAAAGCTGATAATAATATATTGTTACAGACAAATTCATAAAGGCCATATTATCACTAATGAAGGGGTGATAACTAAATGAGAAAAACACTTACTCGTACTCTTCCACTTCTTCGTTGTCTGACATGTTTGCTCTGTCCAAAAAAAAAAACAAAAAAAAACAAACAACATAAATTTAAGGATTGTTATATATTATATTATGGCGACGCAGTGGCGCAGTAGGTAGTGCTGTCACCTCACAGCAAGAAGGTCGCTGGTTCAAGCCTCGACTGGGTCAGCTGGCATTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations