ZFIN ID: ZDB-ALT-980203-1302
Genomic Feature: tx226
Synonyms: AX26A (1)
Affected Genomic Regions: wnt11f2
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 5: 36516517 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation: Trp>Stop at position 234 (1)
FLANKING SEQUENCE (GENOMIC)
CAGATGGGCTCCGCTTTCTCAGATGCACCAATAAGGAACCGGCGCTCGGGCCCACAGGCCTTTAGACTCATGCAGCTTCACAACAATGCTGTTGGCAGACAGGTAAAGCCTCAACCACATGCTGGATTTCCACAGAAGACTGGCATCATTCACTGTAGACATAGCAGGGTTCCATTCAATTCATTCAGGTTGTCTCAACACAAATCTATTAGGTGACTTAACAATCTGAGTAGATTGAACATAAAACAATCGTTGTCCCAAACATAAAACAACAAGTTGTCCCAAAAAATCTTAAGAGTTGTGTTGATTAAGCTCATTTTACATAAGTAGCATGAACAGGTCACAGTAAATTAATAATGAAAATAGTAATTATTTTTTTGAGTGTTTCGATCAGTATCATGAATCTGTGTGTTCGTGTTTGTAAAGGTGCTTATGGACTCTCTAGAGATGAAGTGCAAATGTCATGGCGTTTCTGGCTCATGCTCTGTAAAGACCTGTTG
G/A
AAGGGTCTTCAAGACATCAGCACCATCTCCGCCGACCTCAAGTCTAAATACCTGTCGGCCACCAAGGTGATTCCGCGTCAGATTGGCACACGCCGGCAGCTTGTGCCCCGAGAGATGGAGGTGAGGCCGGTTGGAGAGAATGAACTAGTCTACCTGGTCAGCTCACCGGATTACTGCACACAGAACGCCAAACAGGGGTCACTGGGGACCACAGACAGGTGAGATTGACACGCATCATCAATCAAGATTATTGATCACTGATGAGTTGAGAGGGAGCTATCAGTCTGTAATGAATGAGGGATTATCACTGATCCCACAGACGGGACAGAGCACAGGGTGAAAAGAGGCACATGAATGGAGTGGGTTAAACATTGTCAAGGCGCACAGGCATGAAAACTGATTCTTGAACACAAATGGCCTCAAATGTTGTTGTTTGACTTTTTGGCCAGTGTTAACGTACACCATCAGGGTCTTACAACAGGGTGTTCGTGGGGTCTTAA
(1)
NOTES
Comment Citation
The point mutation TGG (W234) to TGA (Stop) results in the truncation of the  ... Heisenberg et al., 2000
OTHER tx226 PAGES No links to external sites

CITATIONS  (32)