Community Action Needed: Please respond to the NIH RFI
Genomic Feature

tm110b

ID
ZDB-ALT-980203-1228
Name
tm110b
Synonyms
  • M110B (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (2)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 2: 41530550 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C (1)
Transcript Consequence
Missense (2)
Protein Consequence
Amino Acid Substitution: Cys>Arg at position 91 (2)
Sequences
Flanking Sequence
GGGTTAATTGATCTGTGTCACTGATGCTCCCTGGCTCTTATCCTGTGTAGTCAATTTGTAAAGCTGACAGAGTTCAGTGTCACAGGAAATGAAGGCAGGGAGAAGGGAAGAAAACAGCCTGAGTTATCAGGCTTAGAAAGAGTCTCGTCTGCAAGGACTGGCGTCACGCTGGTCTTCCTTAATTAATTTCATTGTTCCCAGAGATTTTTTAGCTGGTGACAACTGACAAATGGCTACAGACGAGTTCCTCTTTCTTTAATTCATGATTTAACTCTCTGGTTTTCTGTCTCTCTCCAGATGTCTCCATTGACTGCATGTGTGTCGGCAGTGACTGTAATGAGCAGCAGTGTACTGGTGACCAGTGTTACACCTCCGTTATCATTAGCAATGATGTGACGACGTTCAAGCGGGGCTGCTTGATCGGGCCGGCGAGCAAGCGCATGACCTGCTCCGCAACAGCTTCTGCTAGTCATGTGGTAGAATGCTGTTCTCAACACATG
T/C GCAACGCCAACGTCTCCAAAGAGACCCTACTTCGACTGCTGCTCACAAGTAAGACTTTTAATCTGTAACTGGCAGGAGAATCGACATCTGGAGCTTTCCAGAAGTACTGTTGTGTAAACGGAGATCAAGATTAAGGATATCCAGACAAAATTCTTTCCAAAAAAAAGTCTTTGCAGCTTTTCAAATTGATATTGATTTTAAATATTATTGTTCATTGCAGATGTGATTTTTCAAACATTTAACATTTACAAGACTTGATACATTTAAAAAAATAATAATTATAATATTTTTTATTAATTTATCTGCTTTAATGTCAGGTTTTTTATTTATATTTCTTTTATCTATATAATTTCAAAAAAACTTACCAGTTGAATAAAAGTAACTTTAATTCAGAGGGAATTAATAATTTTAAGCTTGACCATGTGTATTTGTATATAAGTTTTTGTATAGTAATTTGTATTTTTGTATGGTAAATGTTTTGTAAAGTTAAAACAATAATT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
tm110b.pdf
Citations