Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ti282a

ID
ZDB-ALT-980203-1091
Name
ti282a
Synonyms
  • AI82A (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 13: 28498881 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
acerebellar ti282a mutants have a G>A mutation in the 5' splice donor  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A in Donor Splice Site of Intron 2 (1)
Transcript Consequence
Splice Site, Exon Loss of Exon 2, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CGCATTTAACTCAAAAACTTCATAATAATTTTAATTATTTATTTATTTTAATTATTTATTTAAGTTGTTGGTATGTGGGTGACATGTGATAACAATTCACATGTTGTTTATGTACTTGCATAAAAGGTAAAAAGTTTAAAGCCCTGCCAGAAAGCCTTTGGTTCCTTCCAGAAGAATTGAAGTGCACATGTTTTTATCATTCTGCTAGATTTTAAGCTTACATAAATCCTAAAGAGTAGTCCCTTCGGATTTCACATATTTATGCCCGTATGTATGCATATCTCTTTGTGCATATGCGCATGTGTGTTTACTCCTGAACTTTTCCTTTTTGAAATGTAATTCAATTTTCCACAAAGTCACAACGTCTAATAAAATCTTCTTTTCTTTTTATAGCCAAGCTTATAGTAGAGACGGACACATTTGGGAGTCGAGTTCGAATTAAAGGAGCTGAAACAGGCTTTTACATCTGTATGAACAGGAGGGGGAAACTGATTGGCAAG
G/A TATGTGAAAAAGTCATCACTTTTGTGACTTACTAAAACTGTTCAGTTGACATCCCAAACACAGCATATGCTTCAGTCATACCGCAAGATTTTGAATGCATGAGAAGAATCCCACCTAGAAAGGGAAAAAAAAGATCAATTAATTCAGAAACGTCACTCATAAGCTCATGTAGTAATTTCAGCATTCATTAGTTTGTAGATGAGACATTTCTGATTTAATTAAGATGATTATTCAAAACATCCATCAAATTTATATGTTTTATTTGTTAGTTGGCACTAGACACCTTCTGGTTGCAGCAGGTAAAATCGAGTTTGAAGAATGGGATCTTTCTTCCTTTTTTTAGCTGGCTACTCTTGTTCCAATGTGGATTTGTGCCTTCTCCTTGCTGTGAATGGTAATAAAGTGGGATGGAGGTTCGGCCCCCACCTCCCAGCACCCTACCAGGTGGACCATCTGCTTGGCACCCCTGATCTTATGCTATCTGACATATTGGCCGCCCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations