Genomic Feature
ihb711
- ID
- ZDB-ALT-230926-13
- Name
- ihb711
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one insertion (1)
- Protocol
- embryos treated with
- Lab of Origin
- Yonghua Sun Lab
- Current Source
- China Zebrafish Resource Center (CZRC) ( order this )
- Other Pages
-
Notes
Comment | Citation |
---|---|
>WT gcgtagatcccctccaccacccctcatcctctctctctccctcc >ihb711(+26bp) ... | Zebrafish Nomenclature Committee |
Variants
- Variant Type
- Insertion
- Variant Location
- Chr: 21 Details
- Nucleotide change
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- 26 bp inserted (1)
- Transcript Consequence
- None
- Protein Consequence
- None
- Flanking Sequence
- None
- Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None