Genomic Feature

s717

ID
ZDB-ALT-210223-1
Name
s717
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 18: 946529 - 946544 (GRCz11) (1) Details
Nucleotide change
TGCAGTCGCTGTGGGA/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
16 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TAAACGATTAAATTAAATTATAACCTACTTTTGAATAGTTATTTTATAGTGCAATAAAATAACATTATTATTTTGTAACATGCATGTATATAAGATTTGATTCTTGTATTTTAAAAGATAATTTAAAAAATGTATTGAAATCTTTGCATCATTTTAACGTCTGTTCAAAAGGGGGTACTGACAGTTAGAGGGTTAAAATTAAAATGCTTTTTATTTTACTTGATGTATATATAGTTTAATTACATTTAAAATTGGTCTTTTTTATTGAAGTTAATGCTAAAAAGAAATTTATTTGAAAATTTTGGACTAGTGAATGCATTCATGTTTGTGTGTGTGTCAGTATTTCTCTCAGTCTGAGTGTTTGCTGGTGTGATTGTGTGTAATCCTCCTTCCATCGGATGGCGCTGTCAGATTGCCCGTGAGGCAGAGGCCGCCACCTTCCACCGGCAGCTGTTTGAGGGTCTGAGACGCTCCTCTGTTCTGACCCGTGACCCTTCAGA
TGCAGTCGCTGTGGGA/- GCCGTCGAGGCTTCCTTCAAATGCTGCGCCAGCGGCATCATCATACTCACCAAAACCGGCAGGTAAGGGGAAGAGAGAGAGACAGAGCAGGACAGGTAAGATTGAAGAGCCAATGCGATGTGGTGGGTTTAAGAGTGCATTCACACCTATCAATTGTTTTGTTTCGAAATAGGGATTAAGATTGTTAGTGTTGTTCCTGGTGTGGTTCACTTTCACACAGCGAAGTTTCTAAACTGACCAAAATACGTGCGAGTTGGATTCCACTCAGCTGTCATATGTTAATATTTAAATTTATGACGATGAGAAATAAGACCTTTAGAAGCGAAAAGTTGCACTTTAATTTTAAATGGTGACACTTGGTGACATTCCAACCCAAATCAGACACACCTGGGCTAGCCAATGAAGCTCTTAAGCCGCGGTCACACTGGACTTTTCTCCCCATAGACTTTCATTCATACGCACGTGAATGCGTCCGACCATAAACGCGAGCTTGTGCGACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations