Genomic Feature

zf2223

ID
ZDB-ALT-200311-12
Name
zf2223
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with TALEN
Lab of Origin
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 3: 45767977 - 45768005 (GRCz11) (1) Details
Nucleotide change
TGATTCAGATTTATGTGAATGGCACCGAG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
29 bp deleted in Exon 1 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
TGATGGTAATACTGTATTTTAATATTGTGTTATTTCAGATATTATTTCCATTCTCTTTCTCTTATAACAGGTGTTGCAGCTGTGCTGTTATTGGTAAGACTAAAAAATCATGCTCATGGACTGGAGGAAACAAGACTGCGCTGGACTAAACACGTGTGAAAAACAAAGCGTGCAAAAGAAAAAAAAGAAGCAAGATCCCTAAGGACTGACTCTAGGTGTTAGTGCCATGGATCACACAAGCCCAGGCAGCCTCCATAGCTGAGAGACTGCCATGAAAATGGAGGTCTTCAACCCAGGCTCCATCTCTAGAGGCAAATCTTCATGGATGGCATCTACCAAACATTAAGCATACATCAAGTTGCCGTCACAATGCGAATGCATCCTAAATGAAGGACCCTCATTACAAAGTGAACTGGGCAGTGACACAGATGAAGTATGTAGCACCTTTTACAGCATCTAAAACAGAGACCTGGTCAGCATGGAGGAGCAGACTACCAATG
TGATTCAGATTTATGTGAATGGCACCGAG/- CAGTTCAATGCTTCGTTTGACTTCAACATAACTGATGTGAAAGAAAGCACAGACACCTATGAGTTTTACATCATCGGCCTGTTTCTCTCATGCCTGTACACCATTTTCCTTTTCCCAATTGGTTTCATTGGGAACATCCTCATTTTGGTGGTCAACCTCAACCACAGGGAGAGGATGACCATCCCAGATCTGTACTTTGTCAACCTGGCTGTGGCAGATCTTATTCTGGTGGCAGACTCTCTCATTGAAGTCTTCAATCTCAACGAGAAGTACTACGACTATGCTGTACTGTGTACCTTCATGTCGCTTTTTCTCCAGGTAAACATGTATAGCAGCATCTTCTTCCTGACATGGATGAGTTTCGACCGCTACGTTGCTCTCACCAGCTCTATGAGCAGCAGTCCATTGCGAACCATGCAGCATGCCAAACTCAGTTGCAGCCTCATCTGGATGGCCTCCATCCTGGCAACTCTGCTTCCTTTCACAATTGTGCAGACGCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations