Genomic Feature

udm301

ID
ZDB-ALT-200219-4
Name
udm301
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Samarut Lab
Current Source
Other Pages
Note
Loss-of-function allele. Indel in exon 4 results in a premature stop codon (M189X) early in the glycine cleavage domain of Gldc. Homozygous larvae die between 7 dpf and 9 dpf.
Loss-of-function allele. Indel in exon 4 results in a premature stop codon (M189X) early in the glycine cleavage domain of Gldc. Homozygous larvae die between 7 dpf and 9 dpf.
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 5: 66177374 - 66177383 (GRCz11) (1) Details
Nucleotide change
CAGCCCGAGG/AATAC
Variant Notes
Loss-of-function allele. Indel in exon 4 results in a premature stop codon  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp inserted / 10 bp deleted in Exon 4 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Met>Stop at position 189 (1)
Sequences
Flanking Sequence
TTAAATTTGGTCTGTCTTGATTTTTCCTGTTTATTATTTTATTTAAAATTTCCCCCCGACATATTAATTTGGGGGTACTTAATACCATCATTTTTAAGAAGTTGTTTTTCCTACTATGGAAGTCGGTGGTTACATGATTTCAACTTTCTTCAAAATATCTTCATTTGTGTTCAGCAGAATAAAGAAACTCAGAGATAAATAGTGAGTAAATGTATTATTTTTGTGTGAACTGTCCCTTTAAACTCAATACTAGTGTCTCGCAAAATACCGGAAGAAATCCACGCCAACGCGGGGAGAACATGCAAAAGCCACACAGAAATGCCAACTGACCAAAACCAGTGACCTTCTTGCTGTGAGGCCACTGTGTCGCCAGAATTGCATTTAATTTTTATTATTATTACTTTTATTATTACATATAGGAGTAGCATGGCTTAATGTCTTAAATTAGTGCTTCAGTGAGTATTTGTGTTCTCTACAGGGTGACCCAATACACACCGTAC
CAGCCCGAGG/AATAC TGTCCCAGGGCCGCCTGGAGAGCTTACTCAACTATCAGACCATGGTGTGTGACATCACAGGGATGGCAGTGGCCAATGCGTCGTTACTAGATGAAGGAACCGCCGCTGCAGAGGCCATGCAGCTCTGCAACAGGTTACTGCAGGAACATTTATATTGCTTTATGTGTTTATTCTGTTAGCCAACACCTGAACCAGACCATCCAGGTCTTTAGTGTTCAGGATGTTCCCTCCTCGAGGCTAGGAGGGATAATTGACACTTGTCTGTTTCTTTTTAAAGGCAAAACAAAAGAAGAATGTTCTACATCGACCCACGCTGCCATCCTCAAACGATTGCAGTTGTGCAAACTAGAGCCAAGTACGGAAATGATGCAGTCTCTCTCTCTATCTTTCTCTTTATCTCTATTTCTAGAATAGTTTGGCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations