Genomic Feature

ncv124

ID
ZDB-ALT-191114-2
Name
ncv124
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Mochizuki Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 4: 18878561 - 18878570 (GRCz11) (1) Details
Nucleotide change
CTTCTATTGT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp deleted in Exon 3 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
AATTCACCTATAGCACATGTCTTTGGACTGTGGGGGAAACAAGAGCATCTTGCAAACTCTACACAGAAAGTCCAGCTGGGACAGCCAGAGCGACTTTCTTGCTGTAAGGTGACAGAGTGCTATAGTGTCACCCTAGTCAAATATGCGTATTTTAAAGATATGTTAGTATGTATTAATATTTATTAATGTGAGCAATCACATTGTGAGATATTAATTTTTTGTGTGATGTATTTTCTTACCCCTCTGGCAAAATAAATCATATAATCTGAATGCCTTTCTTTGATAATGCAACTTAAACAATATTTTTGTCCAATTTTTATATTTAAAAAAAATGCCACAGACTATTTTAGGAAACAAAGACAACTAACAGCCCTGTGTCACTGTACTGTGTGCGTGTGTTGGCCCAGGAAAACAGTCAATTGCATTTTGAGTCTGGAATCCATTATTAAGACAGTGGTTTGACAATAGAAATGATGCAGAACTTGCCTTTCTGTACGAGT
CTTCTATTGT/- AGGGTCATACTTCTCCACAAAGATCCCTTGGACAAATTGAACAGTCTGCAGAGCGAGAGAAAGGAGGAAGAGAAGGAAAAACAAAGAGAAAAAGACATCTCCATTAAACGCCACGATACTCAAACACTGGCATGTTGACACAGCATAAAAACACTTTCACTTCCAGTGGCTGATGGGGGATTTCCAATTCAAAGACTCCTAAGGTTTTGCGTCTGCTTATATGACAAACAAGTGCTGAGTATCATTGTTTTCTTCATCCTGAAAACCAAGTAGGGGCTGTATGTGATATAACAGAATAGCCACTTCATGGAAACAGACCAGGAGTGAAACCTACACTTGCTGGTCAGGAGAACAGAAAGCATTGCGATGTTGCTGGGAAACTGGTTACCAAGCAATTAACTGGCTATTTAAATATAGAACGACTTATAGATGATATCCAGAGGTTGAAGGTAAATCGCAGGCGGTTGACAATCCATTGGGCTGAAACAAAATAATAATTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations