Genomic Feature

zf2161

ID
ZDB-ALT-190909-15
Name
zf2161
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 7: 24605073 - 24605074 (GRCz11) (1) Details
Nucleotide change
CT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CATTTGGTAGAGGTTAATATTTTAAAAATTATGGAATGTGTTAAAAAAATGCTTTGAGTGTCTTAACTAGCGACATTAGGGGTTAAGAAATGCAATCCAATTTTTTTCTTGGTAGGGTAGTTATAGGATTAAGAATGTTTAGATAACTAGACTAGAAACAGGAGTGCCATAGTTGGTGCAAACATATTCATAATGCAATGATCAAATGCTTTCTTAACACCTGCTTTCTCATTGCCAACGCTATTCTGTCATGTTTATTTTGATATTTCGAGAAAAAGAGTGAAGAACATATTTACATATTCACCTATATATCACTTTCAGCAGTACATGTGGCTTCAGAATGGCTGCTAACAGTATATTATAGTAAAGCTATGTCAAACTTCTTATATATTTATAAATAAATATTGGAAACAAACTTTGCTGAAAGTACATTGTCAGTATATTTACACAAAAAAACACACCTCATCATCGGCCTGCTGTAGCCTGGCGACGGCATAGCG
CT/- TGACGGTGGGGTTGGTGAACTGCGACGACAGCAGCTCCAGTGAATCCTCCACATCCATCGGACGCCACTTTCCCAGTAGCTCCAGCGCCTGTTTGGCCTCCTGAGGCAGATCCCAGTTCACACACTTCAGGAACTTAGTGAGAGCCTACAAACAAGAGACACACAGTGAGCTTCTGCTTTGAACAGAAATTAATGGAATAGTTCACCCAAAACTGACAATTCTGTCATCATGCACTCAACTTTCACTTGTCACAAATCTGTTTTAGTTTCTTTATTCTGTTGAACAAGATAGAAGTTTCTTTGAAAATTTTTAAAACCAACAACCATTGACTTCCACAGTAAGTTTTTTCTGATTCTAACATGCTTCAAAATATCTTATTTTGTGCTCAACAGAAAAATGAATCTCATTTTTTCTCCATTTAAAAATAATGGTTTTTTATCGACATGGTTCCACAAAGAACCTTTACCATCCACAATAAATGGTGAAATTGTGACTAAAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations