ZFIN ID: ZDB-ALT-190529-2
Genomic Feature: fb105
Synonyms:
Affected Genomic Regions: tp53 (1)
Type: Indel (1)
Protocol: embryos treated with TALEN2-tp53TALEN3-tp53
Lab Of Origin: Langenau Lab
Location: Chr 5: 24086207 - 24098272 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 3 bp inserted / 12066 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TCTATGTAAAGCACAGTAATTTTAATAAGCCTTTGGAGCTCATTATTTTATAATATCCAGTAAACCACTAATAACCGACTTTCAGTTTGTTCTGTAGATTGCAATTTGACGCCTTCCATGTGATTTCTTAAATCACAGCAAGGACACATCTGCCTCGCATCCCTCTGTTTATCTACCATTACAGATCCTTTCTTTGTTTCAATATTACTATTTCTGCGAAACGCAAGGTCAACAAGTGCTATTGTTCAATATAATATATAAAAACGCTGCAGATTTAAATCGTCTACGCGACCTGGATGCAGAAAGTTCACTGGACAAACAACTTCCTCGTTTAATAGATCCCGCCCTTTTGCAACACTCGAATTAATTGGCATAAAACAGACAACGTTAGTTATAAATATAAAGTGGAATGAAGCATCGATTCGTGCATTAAAATCGATATTTTTCTGCAGCGTTTTCTTTTTTCTTTCAATTAATTCATTCTCTGTCCGTCAGGTGAC
GCTGACGTCACATGCTCCTCCTGTAACTAGGGGAATCCCCAAAACTCCACGCGGATTTGCTTTGTGGATGTCCAATAACCTCCTTGTTTTGGTCATTCTTTAAGTCGATCGACTACATATCCGGGCAATCCGAAAGTCGATAATCGTAGTTTAGTGGAGAGGAGGTCGGCAAAATCAATTCTTGCAAAGGTAACAAAGCGAAACTTTTATTGACTAGCGTTAGTGGTTTGATCGATCATATTTATTAACGTTAACTAGTGTTTGTAGATTCAGCTGTTTGTATATTAAGTAAAAGTCGGGATTTGGTGTGCAACATCATTGGACCGCTTGTGTGTTGTATTATTGTAACAAACTGACGTCGATTCGATAAAAACTGGTAATGAATTAAGAGTGAAACTCGTATTTCGAACTTTAGGCCCGACATCGCTTTAAACGTTACTAAAACGTTGATGTTAACGTTAGCCGCTAAGCCTGTTAGCTAGCTAACATTAGCTGTCGAAAATGCAAACTTAGAGTTTCAGTATAATAGCTTTAGGTGACTTTTAGAAATCTTATGTACAGGTATGCGCATTTTTATTCATTTTTAGCTATATCTACTTGCGCGACAGAACTGTGAAGCTAATAAGCTAACGTTAAGCGGCATCTTTGCGACTCTGAGCGATCGCCTGTTTTTTAAATTTAAAGTGAATGTACATGTTATATAAATATCACACTTTGCATAAGAAACAACATCCCGACTTTTATTTTAACGTTATAGTAATTTTAGTTGTCGTGATATATTATTTCCCCCCAGGTTTTTATGACTTTCGTGTTTATAATTTCACAGCAATGGCGCAAAACGACAGCCAAGAGTTCGCGGAGCTCTGGGAGAAGAATTTGATGTAAGTTCGCAAGGGTCGCACTCCTGATACACAACGCTCCTCTTTTTCCTGCCTCTCTAAATTTCCCCGTATTTTTGTTAGCAGCCATGTCAGGTTGCTATAATGTACCTGTCTTAATATTTTTGGTGTTTGCTTGTTTAAGATGCATCTGTCGAACGTATTGTTTATCTGGAGTTCTTTGTATGAGCTTCAACAGATTAATACTAATTTCTCTCTCTTCCTTTTCAATTGTCTCAGAAGTATTCAGCCCCCAGGTGGTGGCTCTTGCTGGGACATCATTAATGATGAGGTATTTAAAAAAATAATCTCAAACACCCAGAAATCTCTATTTTCCTCTTTTGGTTTTCAGTGTTGAACTTTTGTTTGTTCTGTGTTTGCCAGGAGTACTTGCCGGGATCGTTTGACCCCAATTTTTTTGAAAATGTGCTTGAAGAACAGCCTCAGCCATCCACTCTCCCACCAACATCCACTGTTCCGGAGACAAGCGACTATCCCGGCGATCATGGATTTAGGCTCAGGTTCCCGCAGTCTGGCACAGCAAAATCTGTAACTTGCACTGTGAGTCAAAAGCGCATACACACACATACTTTCACAAATTTAATGGAAAGAGACATTTCAGTATAGTTGATCAATCTAGTAATCTTAAATTAAACATTCATAATCCATAATGAAAATATCACAAAACTGTATGTAGAAATCTGTTTGCATATGTGCCATGGTTTGCTCATAATCTGTGTAAATTATTCAGAAATAAAATTAGGGTTAGTGACAAATATGACTGATAATATACTGTATAAGTGTATGTGCAAAGTGGTTATATGATGGTAGTAAGATGGCTAACTTCAGTATGTAGCATATAGTAGTCTAAATGTGGACATGTAGCTGAAGTCATGCAGAGATGCAGGTTGTTCTTACTGGTGAGCGTTGAATCTGAATGCTGAGGATACCACACGGCTTCATTCATTCATTCTTCCCCTCCTCCTCTCCTGTGCTGAATGATATCTCAGGCCTCCTATCTTTTGTATATTCACCACTTGACTTCAGAGATGGTTGTTGTAGTCATTTAGCTCGTTGGTCTGACATCAGGTGTGGGCAAATAAGAAGATTATTTCTTACAGCATTGTCTGAAGACATGAATGGGCATGTTCTCATGTGCAGCGCCAAAAAGTTATCCGGTAGTGGTGGGGTTAAAAAAAAAAGTGACGTCGCACAGCGTACCACCCACAACCAAACCTTTTTTTTTTTCTTTCTTCAGTTGAACTATTGGTTTAGAACTTTTTAAATGCTCACTTTTTAGCCTAAATATTTACTCTGTAATCTAATAGCTCCTGTCACCCTACATGAGTGAATTGGTGCGGAATAAACTTTAGATGTTTAAATTGAATTTTGAAAACCGAGGCTATTTTATTTGCTTTAATAGTGAAATTAAAGAGAGATCATTCATTTGTGGTTAGGATCAATGATTTGATAATTAAGTCAAAAAATGTTGTTAATTTATTTTGGATGTTTAATAGATAATTATCAGGAGATGTTATGGCAAGTGAGTTTTTTTACAACGATATGTGGAAAAATTAAGTTCTTACCAAGACAAGCTGATCTGATGTTCATTCTGTCAACCGACATGGGTGAATTGGTGAATGGATAAAGTAAACGTCATATGTTTGTTTAAAGAGGTTGAGAAAAGTTGTACTATTGACTTTTTAATGTAGCAAGAAACTTTGTTTATTTTGTCAAAGCGACTTGCAGTAAAGGGACAAGCTGTTTATTATGGTGAAATTCATACAGTCAATTCCAGGATTATTATTTTAAATTGTACAGTTTAATAACTGCTCTCTTGACTACCTTTTATGAAAAGAGGTGTTGCTCTAAGATGGCTGCATGACAAAAAAAAATAAAATGGCAGCATTTGTTATTGGTCAAGAAAGCTCTTTCCCTTTCATATTCGGTTATATTAGAAGTTAGTCATATACCTCATTCAGGCAGTCTAGCTTATGTGTGTCTTATTTAATCTGACATGTTATATTTTATCAAGTCCAATAATCTGTCTTTCTTATTGATTTTAGTTTTTGTGCTTTGTTTTTGATTAGAGTTTTTGATTTCCTTTAATTTGAGGTGGAGTTTTATTGTTTAAGGCAGAATCAGTGGAGGTTGAACATGTCTGAACTTGTCCTGATTGAGCAGTGGGGGAGGGGAGTGTCTGCTTTTGCCACAGCACAAACTGCAGACTAAAACACTCAGAACAGAGATGTGTTTCGCATTTTTAAAATATCCTGGCGAACATTTGGAGGGAGATGTTGGTCTTTTTATGCATTTTTTAGGATGGAGTGTAATACATTTTAGGATTGTTAATAGTGCTGGACAGTCAAGCTGGTGCTTCACATTCTGTGTGACATTACAAGACCAGGAGGGTAAGACATTTGAAAAGACATTTAAAAGGCTTGAATGTAAGTGTGATTAAAATGTGTTAATTATTTTGTAGTTCATTAAATTAATTGGTAATTTTGTAAATCTTTGTGATGATATTGTCAAGTGATTTATGCCTGCTAATCTTTTGTTATTTTATTTAATATTATATTTGTGTTATTAGTTTATTGTTCTGTGCTAGTGAAGACGCATTAGGGTGTTTTTTAACATACTTGCATTTTAATTGAGTTAATAAGATTTGCAAATGCATATTAAAATCAGCCTTCTGGACACGACATTCTTTGAGACCGATAGTGCTTCAGTGTTGATGTTTTGATGATACATTATTGATGAGACAAATTTTTATTCACTTTAAAGGGAAAGTTGACAAAAACCTAAAAATGGTTTTACCCAACCGTCACTTACAGTTTAAACTTATTTGAATATCTTCTGTAGACCACAAAAATTAAAATAAATAAATGAATAAATACTGGCCATTGTCATTTTTCGTATTCTTTTACTATGGATATCAGTGGCCACCAATTTTAAACTTTCTTCAAAATATCTATTATGTTAACAAAAAACAGCAACGTTGGAGCCACTTGAGGTTGAGTAAATTTTAATTTTGGGGTGAACTATCTCTTTAAAGCACCAGTACTAAGGAATACCCCAGTCAATAATATCTCATATTTAATCTGCTTTCTCATTAATTTTAGTCATGATTCTTACATTAACTTGTTTAGTTTCTACCGATACTAATAAAAACTGCTTGGATGGATTATTGAACTTTTTTTTTTAAGTGCTAAACTATAACAACTGGGTGAAACTTATTTTTTTGTAATTGCAGTATTCACCGGACCTGAATAAACTCTTCTGTCAGCTGGCAAAAACTTGCCCCGTTCAAATGGTGGTGGACGTTGCCCCTCCACAGGGCTCCGTGGTTCGAGCCACTGCCATCTATAAGAAGTCCGAGCATGTGGCTGAAGTGGTCCGCAGATGCCCCCATCATGAGCGAACCCCGGATGGAGATAGTACAGACATTTTTTTTTCCATATCCATTCTTGCATCATTCTAGGCCTGCACTATTAATTGATTTTAAACCAAAATGACGATTTGAAAAGGTGTGTTTTTTTTTTGTTGTTTTTTGCCAGAAACTGTGATTATTTTGTTTATTACTATGGCGAGGGAGGCAAGTGTGTGTAATTAAAACGATCCAACTAATGTTAGTTAAAAAGCAAACAACCGTTACAGCAGACCCCCAAACCAATATGTGGAGATGAAATGAAAGCTGCTAACTTCATTTCTGCTCTGCTTCTCTCGTTCACTCTCTTGTTTTGGCTGTTACAGTGATTCTTGTGGATCCACACACGCACACGAGCACAATTTTATATATAGTTTTAGTTAAATTTAAAATACTTTAGTTATTTTCTTAATTTGTCATGACGGCTGACAACTTTATTGTATTGTATTATATAAAAAGTGGTTTCAAATAAACAGTAGCATAGTGTACTTTGTGATTATGATTGGTCTTTTTTGGTGCTGTTAAAGCCACCACATCAAACCTGCAGCTCTTAAAAAATTAGTAAATTGCATTTTTAAATTGCAATTTTGATCAGATAAATCGCAATTAGATTTTTTTTTTCAAATCGTGCAGCCCTACACTGGAATACACAAGCTAAACAATTATAAGGTGTTTACTTTTTGCACTGAAAGTTAATATCTTGTCTGTTTTCTCCCTGCTCAGACTTGGCGCCTGCTGGTCATTTGATAAGAGTGGAGGGCAATCAGCGAGCAAATTACAGGGAAGATAACATCACTTTAAGGCATAGTGTTTTTGTCCCATATGAAGCACCACAGGTTAGTCTCTCTATTTTGATCTGTTAAAAAGTCTACCAGTATTGTAGCCACTAGTTGAACCTCATTAATGCTTTTGATTTTATTTTCATGGAAGTTTAAAGTTGATATTGAAGTTGCTTTGGTATGTCACAGCCTTTTTGTAGGACCCTACCAAAATGTTGTTTTTCCCAAATGTATGTTTATGCAAACTACATTTTAGTAATGTAAGTGTGCATAGTAATGTAGTAAGTGTATAAAATGTAACCTTTAACATAACTTTTTCCTTTATTGCAGTCAAAATTAACATTTCAGAACAGTTGAGTATAAATTACTTGAATGCATTATTACATTGAGAAGTCTGTTCTGCTGTGATATTTTTATCAGTTTCTTCACAGGAAACAAATTTTCATGGCATATTTTGTTTTTGATATGACCATTTTTTTTCCACATATAATAATAAAATGGTTGTGAATGACTCAAAGCAGTTCTACATTTAGTGAGACTACGGATAGTGTAACTCAATTTTGACTGTAGTAAACCCTGCCATTCATTTACATGCTGTTCATATTCACAGACCACCAGCCCATATCGGTTTCACTATGTGAACAGCTCTATTTTTGATGTACTCGTTCAAATTTTGCCAAATTCACAAGTGTCCTGTTATCGATCTAATTGTTTATGTTTTTGGATTCTGTTTGGTTTTGTACAATGAGTGAAGTATAGTTGCATGTTAATTTCAGTTGTAATAATGTCTGAAGTCTTTAATCTTTTAAAAGTAGTAGAATTATATCAAAGGCCAGCATTAGATTTTAACTTTTATCTTTTATGTATTGTTTATTGTTGCTTATTTGTTTGTTTTTTACTGTTGTAATTCTTTTTTTTTTTTTTAAGGGAAAGTGTGATTTACAAACTCTTTTTTTATTTTTATTTTATTATTATTATTATTATTATTATTTACATGAAATTGCCAGAGTATGTGTCTGTCCATCTGTTTAACAGTCACATTTTCCTGTTTTTGCAGCTTGGTGCTGAATGGACAACTGTGCTACTAAACTACATGTGCAATAGCAGCTGCATGGGGGGGATGAACCGCAGGCCCATCCTCACAATCATCACTCTGGAGACTCAGGAGTAAGTACTGCATATTTGATTCCTCCTCTTGTGAACTGCTTTTTTAAATTTATTTTTTATTTTTTTGATGCTTCATGATGCTGCTCTCATATTAAATCACTACAAATTTGTCGATAATTTTTCTTAACAAAATAAGAGTGTGCTCGCACTAGGCTATCCGAAACAGTTCAGTTGCCTTGCCATGGCCCTGTTGGAAGAGGCATGCCATTGGGCTTTGGCGAGGTATGCTTTTAGTGTGAGTGCAAAACGTGCCTGAGCATAAAACTGAAGACCCGACATCACCTTTAAGGGACTAATTGTTCTTTCTTTTAGTTGATTAATTTTATTCTTTCTTTTCACGTAAGTCATATTTTATTAAATGTGCAAACCTTTTCTTCTTTAATGACGAGACGACAACTCTTACCCCACAATATATGTATATTAGATGCTGCTTTGCATCATATACAAAGATAATTATTTATTTAAAGTTCCAATTAAAACTCTGGAAATGCTCACTTAAAGTCAGAGAGAGGAAAGTTTGCAAAAAATTAAGAAATATTCAAATTGAGAAATCAATGGAGAGATGTTCAAATCGCTTTTCGTGATCACTTTATTTGTGCCTTTTTTCTGTCATTTATTGTTTTTGAGCTAATATAAACTGGCTGAGTTGATTGTTTAAAGCATAGATTAACATGATGGGAGAGAGCTCTTAGATGATTAGACATAGACATACCTTATCTTTGAAGGGTTCTCCTGTTCTGTGCACTTTTAACTCGCTTGTAAAAACCAGCGGAGATGAATCATGTGTAATTGATGACAGTTGACAAAAAACACAGTCATATGTTGTATTTCCTGTGTGATGTCGCAGGCCAGACATTTGCCTTCTGCAGGCTGGCACTCTTCTGGACTGAATGAAGATAGATCTTCCTCTATATCAGCATCTGCTACAACTTTTTTGGCACTGTTACTCATGTTAAGTGATTTTGCTGTAAACAAAACGGTTCCTGGAGTTCAAAACATCTCTCGTGATTTAACATACCAATCAATTGGACTCATCTCGCATTTGAATCCATTTTCATCTGGCTCATGCTCAATTGTTACATCCTGCTTTTTTGTCCCACAGAGGTCAGTTGCTGGGCCGGAGGTCTTTTGAGGTGCGTGTGTGTGCATGTCCAGGCAGAGACAGGAAAACTGAGGAGAGCAACTTCAAGAAAGACCAAGAGACCAAAACCATGGCCAAAACCACCACTGGGACCAAACGTAGTAAGTTTGCTGCTACACTGCTGAAAAATATTTTGCCTTATAATAGGAGGGTAATGTGAATCTAACCTGGCAGGTTTGGTGAAAGAATCTTCTTCAGCTACATTACGACCTGAGGGGAGCAAAAAGGCCAAGGGCTCCAGCAGCGATGAGGAGATCTTTACCCTGCAGGTGATTGTCTTATTAATACTATTTTTTAAAACGGTTTAGCAACAAATATGTGTTTAGCCACACATTATTTAAATGCTTTTAAATTTGTTTTGAATAAAATTTATTTGCAGTTTAGACTAGAGCTGCACAATTAATCGAAAAAAAGATCACAATCTCGATTCAGCCCCCTAGGCGATCTTGATCCAGCATTTCTACGATTCTGTCAATAATATTTTCAAGTTCAGGAGAAAAGCAAAGGCCGCACAAGTCTTCATTGTTTTACGTACGTTGTTCAGCAACGTGGACACCCCCAAATGGGTTTGAAAGAGTCACATGCTGTATTTATAAGATATAATCACCTCAATAACCTCAAATATGTAGTTTCTGTCTATATGTAATGATGTATTCACGGCCGCAAAATCACATGTGATGCGAGCTGACCGTCAGCTGTCACCACAGGGTGGGTGCACGCCTGTGAACGAAGTCTATTTTAGTGGACAAAACCTCCATAGGCTGTGAATAACAGGTAATACAGTTGTAAAATAACCGCACTTGAAAATGAAACCGAAAGCACGCACACATTTAAATAATCATATTTCGCATTTTAGAGTTATGATTATGACAAGCATTTGATGTTTTTTTTGTTCATAGTGAACACAAAGTGTAAAGTATGAAAAAAAATATTTAACAGTTTCAGTATGACTACTATAGGCTATAATGTTGAATACAATGCAAGAGGGAATCTGATAATGATACATGTCTGATTTTACCAGTACAATAATTGGTCTAATAATGTCAATGACAGATTGCAAGCATACTTCTTAAACAGTAATTCAACCTCAGAATTATGAATAGTTGTATCCTGATGTCATCACTTTACTGTACAATAATGACCAGGGGCCTCATGTATCAACGCTGCGTATGCACAAAAACTTTGCGTACGCCAGGTTTCACGCTCAGAATCGCTCACGTTTGGATTTACTAACAATGAACTGAACGTGGGAATGTGCGCAGGTTCACGGCAGCTTTCTGGCTGGCGTACGCACATTTTTTGTGCGTGTCTGTTTTATTTCCATTGGCGACTCCTAGAGGCAGTTGTGTTAAATTCTTCTCTACAAAGTGTCTGAGCCTTGCAATGGCAGCTGTATGAGACGGGTTCATATGGTAGGTATGTAAGATTTCCATACCATACAGTTGACCAGCTAAACATTAAAGCACAATTTGCAGCGGTCGCCTGTTTTCCCAATGTAATCTGAGCTATCTACTGCACGCACATTTCTATAAAGACACTATCTGAAGATGAATTTGCATGCGTGAATCAGAAACATTTACATTCAATAAATGTGCAAATAAAATATGATGCACAAACTTATTGATGATTCCTACTTGTCTTTCTCGTGATAAATAGTGGGCAAAATCTGATATGTAGCGGGGAAAAAAAGAAAAAAGAATTCATCAGACGCTGGATTCGAGCCGAGTTTATGCTCGAACGTGACAGTACATGATCACATGCTTCTTATAAGGTGCGCCACTGAGACTTCTAAAGGTTCTGCAACATTTTACAGATATAAACCACACTATTTCTTTTTTAAATGCACTCAGTGCGATGTTCAGACCCAACTGTGTTAACCCTATCAGCTAAACTCTCCCACTCTATTTTTTTCTTTTGTTGTTAATTCCGGAGAACAAACTTGCAAATAACACCGCTTTTCTCCGGTCTACCTCCGAAAGCTGCACCTCCAATTCACATTCTGTTCAAAGTTTCTCTTTTTGCTTGATTTTGCCGTTGGGTTTTCCATTAGCATAGTCATTAGCATATTCATACGGGGGAGGAGGCAGGGAGGGGTTTTGTGCTCGTGCATGTTGCGCTCAGTTTCACGTTCATTCAGATGTACAAAAGAATATGCGTGAGATTCGGCGTACGCAGTGTTTCATACATCTGAAATTTTTTCTGCGTACGCACATTTACAGCTTTGTGCGTACGCAATGTTTTAGTAAGATTTCCACGCAAGTCTTCGTACATGAGGCCCCAGGACATATTTAAAGTCCGTTCAAGTCCACCATTCCAAGTCTATACAACATGTAGCATTTTAACCAACAGTAGACCTACACAAAGCCTATTGCTGTTTTACCATATCTTTGAGAAATAACAATAATAAAAGCCTACTCGAATTAACCTTTATTTTACATCTATTGAATCATGAGAAAATCCTGATCTCTTTATTTTAGGCAAAAAAATCGCTATTCTCATTTTAGCCAGAATCGTGCAGCTCTAGTTTAGACGTGCACAATACACCAGTGGTAAGGTCAGGAGGTGGTATTATTGGACGTATTATAAGAAGTGCATCTGATTGTTTTTGCATGGCACACTCTATGAAGGCTTGTTCTGCAGGACATAATTCCACATTATGCAATACTGTTTTTGCATTAATAAAGATTTTGAGGCTTCACAAAACCTTTGCTGTTAATTAAAAATGCAAATGTATTTATTTATTACCTTCAGTATTTGAGATGACCTAAGAAGTAAATTTAGCAGTTCTAACTTTATTTCTAAGCCAAATTTAAGTTTTCGTTTGTGTTATTGCTCATCCCTGCTCTTACTTTAAACTTGACATTGTGGACTGCAAATATTGTTGGACTTTTAATAAATCCCTAGTGGTTTGTGTACGCATCACCATAACATTTGTTTCTCCATTCAGGTGAGGGGCAGGGAGCGTTATGAAATTTTAAAGAAATTGAACGACAGTCTGGAGTTAAGTGATGTGGTGCCTGCCTCAGATGCTGAAAAGTATCGTCAGAAATTGTAAGTTCTCAATTCCACTGTACAATTTGTGTGTGTGTAATCAAACCATTTATCCAATTTATTTAATACAACACCTGTCAGCAGAGCTAATTTGACATTTACAAACTTCACAATTCTTTCATTCTTTTTCTTTCAGCATGACAAAAAACAAAAAAGAGAATCGTGAATCATCTGAGCCCAAACAGGGAAAGAAGCTGATGGTGAAGGACGAAGGAAGAAGCGACTCTGATTAAGGTGATGGGATGCTAAGAGAGAAAGAAACTGGGAGTTTTGCTCTTTTTGGACTGCCTTTTTTGCTTTTATTACACCAAAAAAAAAAGCTTGTCACAGGGGTCATTTGGGGAACTGCGATACATGTGATCCATTAGTCCTGTTTGTCATGTTTCTTCTTGTTCACTCCACTGGGACCTTTGTTGCTGGACACTGATTTTGCAGTGTTTTACCAGCACTGGCGAGGGCTAAGACTAGCCTGACGTTTTACAGACCCGTTAAATGAACGTTCAGGAACGAAGTTTACCTGTGACTTTTGTAAATTGTAATAATGCCAGTATTCGGTTGTTTTGTAAGCAGCATTTTTTTTTATTTTTATAAAGAAATGAGTATTAGACTAATTGGAACAAACCATCGGAATTGGTTGCAAGCCGATTATGTAATAAAAATACCAAAGCAAAACCGTTTTGTATCTTATATTTTTTTATGTTAATTACTGCTGTTCCTATTTTTGTATTTTAGCTAATAAGAGAAGCTGCCCTTTATAACACGCTTTTAGATTTAGTACAACCATTGTTCTTTTTCAATTGAAGTAGTTGTTGATTTACTCTTGTGATTGTTGTTGAGTAATGTGGCACAGATAAGCTCATAAGTGGCCAGTCTGTTTTGACATGTGCTTGTGCAAATGGTTATGGATTGGATGTCTAAATATGAGCAAATGAAATGTCAAATACTCAGGGCATGTACAAGTCCCTCCTGGAAATCTTGATAAAACTCTTCTACTGTTTTACCTGCTATAGATTTTATGCTGGTTTTGTTTCTTATTACTGTTTACACGCATTTGCCTTTTATAAATATATAAGCGTGCATTTATTTGTAGCTAGCTGAATCATTTATAATTTTTCTTTTTAAGAGAAATGTTTTAAAATACACTCTTTAAAAAAAACATTTACTGTTTCTTGAATTCTTTTTTGGGGGGGTCGGGTCGTGTTTACAGAGCAGTGATATTTTTACAGCTTAAAGAACCCCTATTATGCGTTATGAAAGGTCATGTTTTGGGCGTCCTCAATAACAGGCTGATATGCATGCAAGGTCAAAAAACACTTTTATTGTCTTTATAATATGCTTTTTTATTATTATTGTTCATTTATAATATGCATTTATTTCCTAATTATCCCAACGACTCCCATATTATTTGTTCAGCGGTTCCCAAACCCCTCCTTTGCGTGAAGCTAATCTATGCTGATTGATCCAATGACCCAGTCCCAATGCAGTTAAACACCAGCATATTACTCTACTCTTAACCCTAACCACAAGTAAAAACAACGACACACACATTCAGTAATTTCTCCACACGAGCAAAAGTTGAACTATTTTGAAAATTGACTGGGCTACGCATGTCTGCAAGAACAG/TTA
CTGATGGTGGCCATAGCAAAGGCAAAAGGCAGAGGATCGCGAGTTCAGAAACGCATTTAAATCGGTAAAGGAAGAAACAT  ...
OTHER fb105 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous tp53fb105/fb105 tp53 Unknown

CITATIONS  (1)