Genomic Feature

zf2046

ID
ZDB-ALT-190220-5
Name
zf2046
Synonyms
  • uq1mf (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 5: 65798184 - 65798386 (GRCz11) (1) Details
Nucleotide change
TGTGCAGAGATAGAGCGTGTGGACAGACACCCAACGCGCATGCAATGCACCGCAGAGCTGTAGCTGCAGGACAGTTCCCTTACGGCCTTTGTTTTTGGCTGCATAATCACAAACAGGAAGTTTCTTTGGGCCAGTCGCACAGAGGTACTTCCCCCTTTTGTTTGTTGGAGGTTGTGTGAAAGTTTGTGGTACAGACCCCACGT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
203 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AGAAAAAAGAAACTACTACAATGTCCTATTGTGGATCTATTGTAGTCTGATAGCTTCCTTAGTGAATCAGCGATTGATTTATGCATCCTGCTACTCTGGACTCTTCTCACAATAGACGTCTGGCTTCTTATGTGTCTCAATATAAGAACGATTTCAGATAGATGCAGAGCTTGCACTGAGAATGACTGAATTAAAGAGTAAAAATAAAACGTTAGCTAAACATTTTTGGGGGTTTTCGGAACTCCTTGCTTATTTTAATTTAGTTGTACCTCATGTTAATGGGATAGTTCACTTAAACTTAGCAAACATATACAAATCAGTTTACACAATGTAAAAGCATAAGCAAAATCCATTTCTCCCAATATTCAAGGTACTTGTCCATGTGCAGTTCTAATGAAAAAGCCATTAGCTGAACATTTTAACCCAAAAAATAACCAAAGACATGTTTAGCAGCTGTTTACTTGTCTGTTTTTGGAGAGTCCACAGCTGCTTCCCAGCAT
TGTGCAGAGATAGAGCGTGTGGACAGACACCCAACGCGCATGCAATGCACCGCAGAGCTGTAGCTGCAGGACAGTTCCCTTACGGCCTTTGTTTTTGGCTGCATAATCACAAACAGGAAGTTTCTTTGGGCCAGTCGCACAGAGGTACTTCCCCCTTTTGTTTGTTGGAGGTTGTGTGAAAGTTTGTGGTACAGACCCCACGT/- CGCCCCATTTCTCTTCATTCTCACCAATCCGCGAATGCATTTCTGATCATTTAAAGGGATAGTTCACGCAAAAAACAAACATTGTGTTATCATTTACTCACTCTGGACTGTTTCCAAAACATAGTTTATAATGTTATGTAATCAAGAAATCTTTAACCATTGACTTATACAGCAAAGTAGGTCAAGGTGTTCCAGGAATGGCCAGCCTAGTTATCAGACATGAACATTATTGAGCATGTCTGGGGTAAGATGAAGGAGGAGGCATTGAATCCAAAGGATCTAGATGAACTCTGGGAGTCCTGCAAGAACCAACCGAGGCTCATTGTGGAAACGTAGTCCCGCGGACGTTTCTGGGGACCGCGGAATACATCCCGGCGGGTACGTACGGCTGCAGTTTTTGTTTTTGCGAATCCGCGAGAGGCCGCTGTTGTGCGCTTTTTCGCATCTCAACCGCCTCCAGTTCGCGCAGTTAGCGCCCGCGCTGTTCACGCGTGAACCCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations