Genomic Feature

mi5001

ID
ZDB-ALT-190131-2
Name
mi5001
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Hitchcock Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 7: 39174103 - 39174121 (GRCz11) (1) Details
Nucleotide change
TAACGGCGACTGTGGCCAA/-
Variant Notes
19 bp deletion in exon 3, generating premature stop codon and protein truncation
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
19 bp deleted in Exon 3 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TCATCCATTCATCTGTAATTGGGAAGTTGAAATATTAAAAGGGCAAAGTGTGGTCTCAGCGCAGATGGCTCCATTTCTGTCTTGCCCTTTCATAACAGTACTTATGAAGGAAATTATATCATTATCGCAAACTGCAATTTTCCTTCGCGACAACTGACTATTTCGTGTGTGTTTTTCAGAATGCGGGGCCTGTTTTCCACCCTCCTCGTGGTGCTGGTGGCCTTAATGATCGTGACATCAGAGGCTGGGAAAAACAAGAAAGGTATCAATCATGAATTATACCATCTCCATACTCTCTTCTTTCTTCTCATAGTTCATCTCTAACACATCATGTGACTTTGAAGCTTATTGACGCTGAAAATTCAGTGCTGTTATGTATGATTCTGCGATTAAATGGGAAGTGAATCCAATCATTGTGCTTTCTGTGCCATAGAGAAGAATAAGGGAGGTAAGGGTGGTGCCGACTGTGCGGAGTGGCTCTATGGCAGCTGCGTGGCCAA
TAACGGCGACTGTGGCCAA/- GGCATGAGGGAGGGAACCTGCAATGAACAGACCAGGAAAGTCAAATGCAGAGTGCCATGCAACTGGAAGAAAGAATTTGGAGGTGAGTTAAACTGTGGGTGATTAAAAATAGATATGGTAATCAGGTGGAATTTGCCTCGAGTTATATTTACAGTAAGTCATAGCCATTTTTTTTTTTTTTGAAATTTCTATATTTGGTAGTTTTGTGCCTCTGTGCATTTCTGTTTGTTCTTTGCAGTTGATAATGTCTGACATACTTTACTGTAACTCATTTCCTGCAGCTGACTGCAAGTATAAGTTTGGTAACTGGGGTGAATGTGACGCAGCCACGAGCACAAAGAGCCGCACTGGCACTCTGCAGAAGGCTCTCTTCAACGTCGAATGTCAGCAAACCGTCTCTGTGACCAAACCCTGCACCACCAAGGTCAAAAACAAACCCAAAGGTACATCCTCAACACTCAAACTCACTGAGTAGTATATAGTAATATATAATATATACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations