Genomic Feature

ic3030

ID
ZDB-ALT-190130-2
Name
ic3030
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with
Lab of Origin
Del Bene Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 10: 15291384 - 15291385 (GRCz11) (1) Details
Nucleotide change
-/TCCCTTAAAGTGC
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
13 bp inserted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CAAAACACTGGGTTTTATGGCAAATTTGTCCAGCTTGGAGTCAGTTCAATCACACACAGTGTTTTTAACCCCCTATTCAAGGACACTGCCATGCATCACCCTGTGGGATGTTCCTCATGTGGACCCCATCTGGATTTATTGATCCCTGTAAATCTCAGCATGTCGACAGTTTGTGTGTAAAATGTACAACATTGATATTCCAGATGTGTAAAAAGCCGCCATTCACTTTGTTCTAGATATGAATGAATGCTTGATCAATAACGGAGGCTGTTCGCACATCTGTCGAGACTTGACGATTGGCTTCGAATGCGACTGCACACCGGGACTCCAGCTCATCGATCGCAAGACCTGCGGTGGTATGAATAACCACACATGCTGTTGTAATGTAGTCAAATAATGAATATATTATTGATTATCTGATGATGGATCTTTTGTGAGCGTACTCTCCAATAGGAACTCGGACTATGATTGTTTCTCTGCAGATGTCAACGAGTGCCTCAA
-/TCCCTTAAAGTGC CCCAGGGATATGTAGCCAGATATGTATAAATCTTAAAGGAGGATACAAATGCGAGTGTCACAATGGTTACCAGATGGACCCCACCACTGGAGTGTGCAAAGCTGTTGGTAAGTTCACTTTGAATTTAAGCCTTTCATTTTTTTTTCTTCTTTTTAATTTAATTTTTTTTATTTAATATTATTATTTAGTTATTTTGCTTGGTGATTTCAAGAAATATACAGTTCATCTGAAATTGCGTACTTTCCTACTATTTAGTACACTACCTGACAATCGTCGATCCCAATTGTAAGTGCAACAATAATAATTTGACTTCTAGTTGATCATTTTGGAAAAGTGACTGAAGGTAAATTTGTCCCATGAATGATCTGTTGAACTGCATCCCAATCATCACAATTACTGCAGAAGACCTATTGGAACCCACATGGACCCAATATTCTCAACGAATTCTCAATGGTTTGGGTTTGCATTCGGTATGGAGGCATGGGAGAGTGGATGGAAACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations