Genomic Feature

udm102

ID
ZDB-ALT-190107-2
Name
udm102
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Pierre Drapeau Lab
Current Source
Other Pages
Note
Homozygous larvae typically die between 10 and 14 dpf. If separated early and raised with extra care, they can survive slightly longer, up to 20 dpf.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 10: 17213911 - 17213914 (GRCz11) (1) Details
Nucleotide change
AATC/-
Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp deleted in Exon 14 (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Polypeptide Truncation: 1216 AA missing (1)
Sequences
Flanking Sequence
CATCCGCTGTGTAAAATATATGCTGGAAAAGTTGGCGGTTCATTCCACTGTGGTGACCCCTGATGAATAAAGGGACAACGCTGAAGGTAAATGAAGGAATGAAACCAAATTTTTTTTTTTTTATGTGAAAAGTCCCATCCCTAATTATAACTAATCGCACATAACTTACTAAAGAGAAAATGATAAATGCTGGACAAGGATCTTTCTTTAACACATGCGCTTGCAAACACCATCAAATAGCTATTTGTTTACAAAGGCAGTTCATTAAATCATGTGGCTAAAAACAAAGTACATTTTGGGCTTTAATGTGAAGTACACTAACCTTGAAGAGTGGAACAGCGTGAAGGGGCTGTTCTCCCATACACACCAGATCAACACCAATGCCTATCAGAAACATACCATTTCATCAGCATTAACCTCAAGAAATAAGATCAGCAGTGTCTGAAGTGCACGCTCACTGACCGTTGTCAATCATGCGCTGTTTGGTGAGGATCATGAGC
AATC/- GGTCGACTTCAAAAACACCCACTCCTGGAGTTATGACCACTGACATTTGACCAGTGCGGTCAAAGTTACGGTTGATGTAGTGCTTATCAAACACTAAAAGAGACAAACAGGACACCGATCATGCAATAACAGCTCTACTGAAGAATGTAAACTAAATACACAAAAACAAACCATTGAAAGACAAGTTGATTGCTTCCAGGTAATTTCCTTGAGCAGAAGTGGAGTTGTGTCCACATGGAAATCCATCTGTAATATTGATGTAAATGTGTAAGTCTTGGTAATAAAGTCTTGGAATTTTTAAATAATCAAGTAACAATGGAATAAATTGCTATGGTGTTCATCATTCAAAAGTAAAATTACTTAGTTAAAAGTTAAAGACTGTAAATAAATACTCTAAGTGAGGATGCATAAAATTAGTAATAAAAGTGGCTGAGAGATTTTTAATGTGACAAAATATTTCTCTTTAACAAAATTTGTATACAGCAAAGAATCCTGCTTAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations