Genomic Feature

fl8

ID
ZDB-ALT-181214-4
Name
fl8
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Fadool Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 8: 54076639 - 54076644 (GRCz11) (1) Details
Nucleotide change
GCCTCC/ACTGTCTGGACG
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
12 bp inserted / 6 bp deleted (1)
Transcript Consequence
Inframe Deletion (1)
Protein Consequence
Amino Acid Deletion (1)
Sequences
Flanking Sequence
TAATACTAGGTTCACATCACTGACACAGCTCAATCAAAACATAAACAGAGCGATTTAATTTGCAAAGTGCTTTTTATTGTTACGTTGCCTTGAATACATGCCTCTACAATCACAACAAAGCCAGTATAAGGAGTCCAGCAGTAAGAGAGTTAAGATGTGTTTCCTTCTGCTGCGTTTTAGGAGGAGAGAACAGGAAGGATCTTATGCACCGTTACGCTGGACTCGCTGGATGATGTACTGAAACCAGAACAGGGTCTGTCCTCTCTCAAAACTGTCTTTTGGTTGAACCAATTGGGTTTTGTAAAAATACAAAAAGGAAAACTGACAGACATTTTTTTCTGCAAGTGGTAGCGGTCGCTCGTTTCCCTGGGCTGAGCGCTTCGTGGTCTCTGTGTGGTTTGCCGTGGGAGCCCAGTGCAGGTCGCTGCTTCGAGAGTGTCTGGAAGGAGAGTTTACGCCGGAGACACGGAGCTGGAAGACACGGACGAAGCCTCGGTCTT
GCCTCC/ACTGTCTGGACG GGTGGTGGAGGCGCCCTCTTCCTCTTCGAAGGGGTTCTTGCCGCAGCACAGGGTGGTGATCATGCAGTGACGGAACTGCTTGTTCATGCAGATGTAGATGCAGGGGTTGTAGACGGCGGACGTCTTGGCGAAGAAGGCGGGCAGGGTCATGAAGACGGGCCCGAACTCGCTGCCCTGGTGGGTGAAGATGTACCAGGCCACGCCGGCGTAGGGCAACCAGCAGATGAGGAAGGCGATGACCATGATGATGACCATGCGGGTGACCTCGCGCTCGGCCCGCTGTGTGGTCTCGGACTCCTGCTGCTGCGCTGCCGCCTCCTTCACAGTGCACACCAGCCGGCCATAGCAGAAGAAGATGACTATCAGTGGGATGAAGAAGTGCACGATGAACATGTAGATGACGAAGGACTCGTTGTTGACACCGGGAGTGCGGGTGTAGTAGTCGACGCCGCAGGAGCACTGCATGCCCTCGGGGATGTAACGCGACCAGCCCACCAGTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations