Genomic Feature

fl7

ID
ZDB-ALT-181214-2
Name
fl7
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Fadool Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 8: 54077605 - 54077610 (GRCz11) (1) Details
Nucleotide change
GGTGGC/CGG
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
3 bp inserted / 6 bp deleted (1)
Transcript Consequence
Inframe Deletion (1)
Protein Consequence
None
Sequences
Flanking Sequence
TGCATGCCCTCGGGGATGTAACGCGACCAGCCCACCAGTGGCGGCACGGCACAGGAGCAGGCCATGACCCAGGTGAAGGCCACCCCCATGATGGCATGGTTCTCCCCGAAACGGAAGTTGCTGACCGGTTTGCAGACCACCATCCAGCGCTCAATGGCCAGTACTACAAGCGACCATAGCCCCATCTCACCGCCCAGGGTGGCAAAGAAGCCCTCCAGGTTGCAGCCCAGGCGGCCGAACACGAAGTAGCCGTGCAAGGAGGTGTACATGGTGGTGGTGAAGCCGCCGAACACCATGAAGAGGTCGGCAATGGCCAGGTTCAGCAGGATGTAGTTGAGGGGTGTGCGCAGCTTCTTGTGCTCGATGGTGACGTACAGCGTGAGGAAGTTGACGGGGAAGCCGGTGATGATGAGGAAGAACATGTAGGCCGCCAGCAAGCCATATGCCCAGGGCGCCACCAGGTAGTACTGTGGGTATTCGTATGGGCTCCGGACTACCCC
GGTGGC/CGG ATTGGACATAGGCACGTAGAATGCCGGTCCCTCTGTACCGTTCATGGCTGCGGTTGGATGTGGCGCTCAGCCCCTTCTGCGGTAATCTCTAGATGTCTGGGCAGGACTGTGAAGAAACGAGGCAGGACCGTGCTACGACTGGATGGGGCGATCGGACACCCCGCTTTATAGAGACTCAATGGGGATTAGCTGATGTTTCCAGGCTGTCAGCAGCAGTCTATTTAGGCCAGAGATAATAAAATAATCCCAGCCATCATTGCACTGCATATCTGGCAACTTATCAACTTATTAAGGTTGTACCTGAGCAGCAGGTAGATAATAAGAACTTTCTCTGACACACAACAGCACACTTCTACTATGAAGTTCTCCAACACACAGACAGCAACATCACAGTTGTGTTTGGCTGAAATGATTGAAAGCGGAAGCGTTTCAAAAGGAAAATGATATCGACCTTTTCCATGATCAAGTCTCAGAAGGTCCAGTGTGAATACTGCAGAGTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations