Genomic Feature

fl6

ID
ZDB-ALT-181214-1
Name
fl6
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Fadool Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 8: 54077607 (GRCz11) (1) Details
Nucleotide change
T/GTTAGGGTTA
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp inserted / 1 bp deleted in Exon 1 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CATGCCCTCGGGGATGTAACGCGACCAGCCCACCAGTGGCGGCACGGCACAGGAGCAGGCCATGACCCAGGTGAAGGCCACCCCCATGATGGCATGGTTCTCCCCGAAACGGAAGTTGCTGACCGGTTTGCAGACCACCATCCAGCGCTCAATGGCCAGTACTACAAGCGACCATAGCCCCATCTCACCGCCCAGGGTGGCAAAGAAGCCCTCCAGGTTGCAGCCCAGGCGGCCGAACACGAAGTAGCCGTGCAAGGAGGTGTACATGGTGGTGGTGAAGCCGCCGAACACCATGAAGAGGTCGGCAATGGCCAGGTTCAGCAGGATGTAGTTGAGGGGTGTGCGCAGCTTCTTGTGCTCGATGGTGACGTACAGCGTGAGGAAGTTGACGGGGAAGCCGGTGATGATGAGGAAGAACATGTAGGCCGCCAGCAAGCCATATGCCCAGGGCGCCACCAGGTAGTACTGTGGGTATTCGTATGGGCTCCGGACTACCCCGG
T/GTTAGGGTTA GGCATTGGACATAGGCACGTAGAATGCCGGTCCCTCTGTACCGTTCATGGCTGCGGTTGGATGTGGCGCTCAGCCCCTTCTGCGGTAATCTCTAGATGTCTGGGCAGGACTGTGAAGAAACGAGGCAGGACCGTGCTACGACTGGATGGGGCGATCGGACACCCCGCTTTATAGAGACTCAATGGGGATTAGCTGATGTTTCCAGGCTGTCAGCAGCAGTCTATTTAGGCCAGAGATAATAAAATAATCCCAGCCATCATTGCACTGCATATCTGGCAACTTATCAACTTATTAAGGTTGTACCTGAGCAGCAGGTAGATAATAAGAACTTTCTCTGACACACAACAGCACACTTCTACTATGAAGTTCTCCAACACACAGACAGCAACATCACAGTTGTGTTTGGCTGAAATGATTGAAAGCGGAAGCGTTTCAAAAGGAAAATGATATCGACCTTTTCCATGATCAAGTCTCAGAAGGTCCAGTGTGAATACTGCAGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations