Genomic Feature

djh503

ID
ZDB-ALT-181205-1
Name
djh503
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Mumm Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 8: 54076688 - 54076692 (GRCz11) (1) Details
Nucleotide change
TGCTG/-
Variant Notes
The CRISPRs CRISPR15-rho and CRISPR16-rho were also injected to create this  ...
The allele contains a 5 bp deletion in the 3' coding sequence of the gene  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Elongated Polypeptide (1)
Sequences
Flanking Sequence
GCGATTTAATTTGCAAAGTGCTTTTTATTGTTACGTTGCCTTGAATACATGCCTCTACAATCACAACAAAGCCAGTATAAGGAGTCCAGCAGTAAGAGAGTTAAGATGTGTTTCCTTCTGCTGCGTTTTAGGAGGAGAGAACAGGAAGGATCTTATGCACCGTTACGCTGGACTCGCTGGATGATGTACTGAAACCAGAACAGGGTCTGTCCTCTCTCAAAACTGTCTTTTGGTTGAACCAATTGGGTTTTGTAAAAATACAAAAAGGAAAACTGACAGACATTTTTTTCTGCAAGTGGTAGCGGTCGCTCGTTTCCCTGGGCTGAGCGCTTCGTGGTCTCTGTGTGGTTTGCCGTGGGAGCCCAGTGCAGGTCGCTGCTTCGAGAGTGTCTGGAAGGAGAGTTTACGCCGGAGACACGGAGCTGGAAGACACGGACGAAGCCTCGGTCTTGGAGGCGGTGGTGGAGGCGCCCTCTTCCTCTTCGAAGGGGTTCTTGCCG
TGCTG/- CAGGGTGGTGATCATGCAGTGACGGAACTGCTTGTTCATGCAGATGTAGATGCAGGGGTTGTAGACGGCGGACGTCTTGGCGAAGAAGGCGGGCAGGGTCATGAAGACGGGCCCGAACTCGCTGCCCTGGTGGGTGAAGATGTACCAGGCCACGCCGGCGTAGGGCAACCAGCAGATGAGGAAGGCGATGACCATGATGATGACCATGCGGGTGACCTCGCGCTCGGCCCGCTGTGTGGTCTCGGACTCCTGCTGCTGCGCTGCCGCCTCCTTCACAGTGCACACCAGCCGGCCATAGCAGAAGAAGATGACTATCAGTGGGATGAAGAAGTGCACGATGAACATGTAGATGACGAAGGACTCGTTGTTGACACCGGGAGTGCGGGTGTAGTAGTCGACGCCGCAGGAGCACTGCATGCCCTCGGGGATGTAACGCGACCAGCCCACCAGTGGCGGCACGGCACAGGAGCAGGCCATGACCCAGGTGAAGGCCACCCCCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations