Genomic Feature

it312

ID
ZDB-ALT-181128-5
Name
it312
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with CRISPR
Lab of Origin
Kobayashi Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 13: 13997248 - 13997254 (GRCz11) (1) Details
Nucleotide change
TCGCACG/-
Variant Notes
The 7 bp deletion generates a frameshift after amino acid 783.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp deleted in Exon 13 (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CACCACAGTTAATCAGGAGGTGGCAATTTTGTTTTCTTTGAACAATTAGATGGAAACACTGCTTTATTTGCACATCTATTATGCAATATTGCAGTTATACTCCTATTTAAATAATTTTAGATGGACACTAAGCTATTGTTTGTCTTTCAAACTAACTTTTAGTCTATGTAATGTCTAATAATGGAACTAAACCATTTTTACATCAAGAGCATCATAGAAAAATGATTCTGTGTGTCTCTCTTCAGCACTGCTGATTGGCTGCTGAGCTCTCCGGAACACATGGAGGCTTTCTCTGTTAAGGTTCCAGTGGCCACTCCGTCTCCTGTGGACTCATCATGCATGTGTGCGGCCGGCGGGGACACCAGCGTGTGCGTCGGGGACCAAGTCTGCGTGGAGGGCCTGGGGCCGGACAGTATGATGTCAGAGCGAGACAGTCAGGCCGACCCAGATGCTATTATGGAGGTCTCCGATTCCCCCCACTCCTTTGAGCTCTGCCCACC
TCGCACG/- GTTGCCCACGGCGACTGCACCTCTTCCTCTTTCGACATCGTCTTCGAGGACTCCGGCTGTGAACACCAGGACAATGACAGTGACCTCAGCGGAAGTACACCTGTGCCACCCGTGTGCCTTTCACAGTCTGGCTCCAAACCCCAGCGCAGTACGTCAACAGGACCACCCATTTCCTTACCTTCAAGGCCCACGACTCTGAGTCTTGCTCCCAGTACCCCCTGTCCCGTCGTGCGGCCCCTGCTCACACCGAAGGTCTACCTGTACATTCAGATGCAGCTCTGTAGGAAGGAGAACCTGAAGGACTGGATGGCTCAGAGGTGTTTGCCCGAACTCAGGGAACACACTCAGTGTCTGGACATCTTCCTGCAGATCGCTGAAGCTGTGGACTTCCTGCATAGCAAAGGACTCATGCACAGAGATCTTAAGGTAAAGATGCTGAGAATGAAACCTGGCTGAAATGAAAGGTTTCACAAAATGATCAGCTCAGTCATTTTCCTTTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations