Genomic Feature

a146

ID
ZDB-ALT-180417-5
Name
a146
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Schier Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 17: 8312845 - 8312855 (GRCz11) (1) Details
Nucleotide change
GTGAGATCGCT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
11 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
AATAAAAACTGATTTGATCATGTCATAACAATGTGTTTTTATGTTACTGTAAATTATTTTATTGAGTTAATCAGGTTTCAAACTCAAGTTTCTTTCATTTTAAGTACAAATTTCAACATAAGTTTTAAGTATTTAAGTTGTAAGTTTAATTTATGTAAGTTTAAATGACATTTAAAATTAATATGATTCCATTTTTTACATTGTACTGTTCACTATAATTCATATAGGCATTATATTAATTAGTAATAAAAACACATATGAATTGTGCATAAGTAACCCACCTGCATTGCCGTGTATTCCCCTGAGTATTCCTGCCAGGCTGGGCAGAGATCTCCTCCTGCGCTGGTGATGGAGCTTCAGCATGGACAGATACTTGCTCTTAATGTGAGCCGGGACAACTAAATTCTCCAAATCCCGCTTCTGGATCCTGGGCGGTTCAGTTAGTCCGAGTTTTTGGAGTAGAGCCTGCTTGATGTCCTCATGCTGGAATCCCTGTGTGA
GTGAGATCGCT/- GTGGTCAAAATGAACAGCTGGATGAACAGAGCCATGACTGATCTAACGATGCCAGTGAAAGAATGAATGACTGACTGAAGCTCTGAGGGTTTATATACAGTTTAAAGTACCCCCCTCCTCCTCCTCCCACCCTCCGTCTGGCTTTTCACACCTTCACAAAAGAGAGGGAGCCCAAAAAAGACACCCTTCAAAGCTTGTGTCCCATTTAGACCGACCATTGATGCTCATGTTGATAAGTATGTTCAGAACATTATATAGTTTTTATGCGTCTATGGATAATTAATAGTGTTAGTCAAGTAAATTTAAGTGCATTATTCAATTATTATAATATATTATATTATATTATATTATATTATATTGTATTATATTATATTATACTATATTATATTAGATTTTATTACAGTATATTACATTCTATTATATTATATTACATTGTTACATTATATTATATTCTATTATATTATATTACAGTATAATACATTATATTACACTATATTATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations