Genomic Feature

ki110

ID
ZDB-ALT-171212-5
Name
ki110
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Andersson Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 24: 33780214 - 33780238 (GRCz11) (1) Details
Nucleotide change
TCTCCTATCTTCTCCAGCTTCTCAT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
25 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
ATTACAGGACTCTTCACAAAAAAAATCTAAATATTGTTTTATGATGTAAATACAACTCAAAAGGAGAAAAGCCTATTTTAAGCCCTCGCGCGCCCCCTAGAGGAAAACACACTTTACGTTTCATCATGGCTACCAGCATTTGCTGGATCAAAGAAAACCCTGTTAATGTTGCTAAAATGAAATATCAATCAACGGGATAACAAATCATCACTTTACCAGCTCTATTTCTCTCAATAACAGCGATAATGTCATTTAGCAGGTGTGAAAGGTGTGCTGATTTATCCGATTCAAAGCCAGCTGCATCAAAATGAGCTCGATCTCCACAGATTAAGACTTTTAGGCTTCAGTACACAAGCACATAAAGGCACAAATGCTTTGCAGATTGACAGACGGTTGACGTCTTATGACAACAAACCTTCGTTATTGTTAGTGGTGTATAAATAAATCTCCAATTTATCGTTAGCTTCAGACATTCAGGCCAGACAGTGCTTTACTCACCC
TCTCCTATCTTCTCCAGCTTCTCAT/- ACTTTTGCATGGTTTCAGCCAGTTATTAAAACGTCCTGGCTGCTCGTTTTTTCTACGAATTAATAAGCAGGGGTTTAATTGTACCGCTGATTAATGTCGTTTTTTATCAACAAGGGGCGTAGTACGCAACATGAAGAGAGCAGAGCTACAAGATGGCGACCCGCTGAGACGCGCTTCAAAATAAAAGTACCAGATCGGGTTTAGCTGCAGCCAATCATAAACTTCCGGTGAAAGCTTTATATGACTATTTTTAATGCCATACGGTTCCTTTTACAGCATATATGTTGCAATGTCATTAAAATACATTCAGTTAAATAGACTTAAGCTTTCATTTAGTTGTTCAAGTGTAAAACAAGATAAGACTATATAACCGCTAGCACAATCAGGATTAGCAGGTGAGCGCTGAAACTCAATTGAAAAATACTGAGGTAAAATAAACAGTTTTATTTAAAAGACATGGCAGAGGAAAATTGAATTGATTCAGTGCTTCTTGTCTGGTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations