Genomic Feature

ihb819

ID
ZDB-ALT-171212-2
Name
ihb819
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Cui Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 16: 25533577 - 25533578 (GRCz11) (1) Details
Nucleotide change
AT/-
Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CGGTTTAAGTCCCTCCCACTTGGAGGTTACCCAACCTACTTGCAGTGTAATCCCTTCCACTAGGAGGTCTCCAGGCTGCAGTGATATCTACTTGAATTCAAAAGACTTTAAATATCTAGTACAACTGACATGATATGAATAGCACACTATTCTGTAATACAATAACTATAAATATATCCCTGTATGAATAACTAATATTGGTCATTGATTATTATAATTCTTCTTTGTCATGACTGCTTGTGAACAGCTCACCGATACGTGAGGTGATGGTCTCCAGGTCTGAGAGGAAAGTCGGGATCTGCTGTAGTTGCTCCTGCAGCTCCAGCACAGCTCCCCGTCTCTTCTCCCAGTGTGCGCACAGCATCACAACCTCCCCGTCCACTGTCTGACAGAGAAATACACAAACACACAGGTTATAGTTACAGCACTACAAATGTTCGACTGTACTGATTCAGATGTAAACTTACTTCACCAGACTTAGCACTCTCTTTAGCCCGTTT
AT/- GAAGAGCCACCCACGTGTCTTCATATCTGGTGAAAAAAAAAGCATGTCATGATTACACTCATTGATATAATTTCTTAAAATATTTCTGTAACTAGTTTAATGACAGCGTGACACCACTGACATTTCACTAATAAAAAAGTAAAGTGACTTACCGACTGAGTAATTCTACTCCAGCAGAATATTGGGGAAGGTACTCATCTCTTCTGAAAAATGTTTGAGATCATAAAAATCAATTCAAATCATGAAATCATTAAAATCAATTTAAATGCTTAGATAAATGCCATGATAAATGCTTAGATAAATGCCATTATATGGTCAGACATGTTTAAAAAAAAATGGAAACATAATAAAAATTTATTTTAAGCATCACAATGCTGCCCCAAATACTAACTAATTATCATTTTAAATCTTTATACTTTGCAACTATAAAGTTTGCCCATTTGTCAGCCAGAATTTTCTCATTTAAATATGGTACAGTTTTGCATGGGTGGCATGGGTGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations