Genomic Feature

nc29

ID
ZDB-ALT-171031-10
Name
nc29
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Jiandong Liu Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 10: 7374279 - 7374285 (GRCz11) (1) Details
Nucleotide change
CCCGTCC/CACATTTGAATACCGTTTTTT
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
21 bp inserted / 7 bp deleted in Exon 3 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
AAAATTGCTCCAGAAGGCACCTTTTCAAACATTTCACTTAAAATATTTCCCGGATAAAAAGTTCTCTTACATCATTTAAAAATACACATTCTATTAAAATATGCTTCATCGTCATAAATTCTTACACAAAAGTCACAAATAGGTTTTTCTTCCGATTTCAATAAATATGCGCGTGTGAGTCTTGAGTGTACATCGTGTATGTACTACCTGATCGTGTCTATTTTCAAAACTGTCATTATTTCTTTCATTTACAAATAGATTGTACATGTAGAAATAACCTCTCTGGCTCAATCTTATTTGAAGCAACATCTTCAGATTCAACACAACAAGCAAGTTTTTATTAAATAAGCAAGTATAGTTCGTTGTACTTACTGTTTCTTTTTTTTAATCTTTATGCTTTTGGGTTTGTTTTTGCCTGTGAGCTCTTTTCCGTTCTTGTACCACTTGACATTGGGCGCTGGGTTTCCTGCCAAAATCTCACATTTGAGTACCGTTTTTTT
CCCGTCC/CACATTTGAATACCGTTTTTT TCCACTGTCACGCTCCGAAGGTTTTTTAACTTCGGTTCCGCTGGAAAACAAAAAGACACAAAACACAAATGAAGCCATCGGTGCTCACAAGGGTGAAACTTGCAAAACATTTAGCACATTATTAATAATTACAATGTAATTACAATTAAATTCTAACAGAAATCTATAAAGCTTTGAAGTCTTTCCTTTCTTGCACAAACTATTAAATTAGATACTTTGGGTATCTAAAGCAGACATTGCTGCCCTCAGAGATGAAATGAATCCTTTCTTATTGTACATTTGTTATGATAGATCCCTTCAGTTAGCTATTTAATCACGAACCACAACCATTACACTAACATAAAGCGAAAAAAATAAGAAAGAAAACGTAACGTCTCCATATTTGAGATGATTTATGATGCCATGAAGCTGTCTAGTTAAATGCGATGCACTTTGTGATTCAATTTGTGCGGGAGAAGCTTCAAAACAGCAGAATAAACATTCAGCCTCCAACAGCTGAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations