Genomic Feature

mi4002

ID
ZDB-ALT-170213-1
Name
mi4002
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Shavit Lab
Current Source
Other Pages
Note
The deletion causes a frameshift starting at amino acid 111, and a premature stop codon 13 amino acids later.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 23: 36312539 - 36312546 (GRCz11) (1) Details
Nucleotide change
TCATGTGC/-
Variant Notes
The deletion causes a frameshift starting at amino acid 111, and a premature  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GAGGGCTCGCCGTTCATCTCTGCTGAGGGGTACAGGAACACTGCTGGATTTACACTTTGGGTATGGGGACTGATATGAACCTACTCTTGAGCTATTTAGCTGTAGATCATCCAAGGCTGTGGGCAAAACTGGTTGCTTTATTGATGCCACCGGACTGTAAGTGTGCAGGTTGCTAGATGGCATGTTTGCAGATGTTGGAAAAGAAGCTCCAGGATATGAGCTGTATGACTGCTGGTAGTCAACAGCCCCATGCAGATTAGGTCGTAGGCGACATTGTTCCCCAATACTTTCACTTTCAGCATAGCCTGTAGAAATATCAGTAGGCAAATATGCAGGAACTCCATGTACTGCGTTCTCAGGAGAAGCGAGCGGCGGACTCGAACCAAGCGACAAACCAGAATCTGACTCCAGATCATCTGTACAAACTTGTTTGATTTGTCCTGTAGAGTGAAAATTAATAATACCATCTTTCACAATCCCATGACCACGTGTAGTCATGT
TCATGTGC/- TCCAAAAGGCTCATAAGAGGTGGGTGAAAACCTTGTGTATTTGCAAGCATTCTGGAAGAACCGTGGCCACCAGCAAGACCGTAGTGCATATCCATGTGTGGATAGGGTGGCATCATTTCCGGGTATGCGCTTTCATATACACCAGAAGGATGGGCATCACAAGTGGCTGGAATGGATTCAGGCTGTGGCTGATTCATCCCGAACCCCCCTTGAGATACCATGGGCTCCATGGAGAGGTATGGAATTGCTTCGAAAGGATTCTCATTGGGTTCCTCAAACTCCTGTGACAAAAACAGTGTGTTTTATTAACAAGAACTTACACCAATCTGTCCTTGGAGGTGATTCAAATCCAACTCTTTTACAATTAAACACCCTGGGAAAGTAGCATGGGTTTGAGCCGAGAAACCATTAATTTGTTCTGGGTTGTGTTCAGTCAGGACCAGCCCACCTGGGTGAATGTGCCACCCTTAGCTTATGCAGGTCTTACTTAGGAGAGCTCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations