Genomic Feature

ioz8

ID
ZDB-ALT-170119-4
Name
ioz8
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with
Lab of Origin
Liu Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 20: 7584250 - 7584251 (GRCz11) (1) Details
Nucleotide change
-/CCGT
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp inserted in Exon 1 (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CAGAATTACTTTAAAATACATAAATTAAAAAGAACTTTTATACCAATAAATATAATTATATTACAACTACTATTATTTTGAAAAGCTTTTGACCGGAAATGCATGTAATAGTAGCTCATTGTTGCTGACTTCAGTTTTTTTTTCAACTGGCAGAGTTGACACAGCCCCACCTATCTCTGTATAAAACATGTGTATCTTGATATACAGTTAATAAATTATATCAATCAATGGCCCACATTTTGTTTTCAAATTTATTTAATAAATTTATTAGATGCATGCAAGGAAAAAATACACAAAAAAAGTGGTATCAACTAATATGACTATTTAAATTAAAATATTAATATACTTTTCACCTTCTTGACACATCATACATAAATCTGTTTGGTTCTAAAATAGTCCCTTTCGTTTCACTGCACAAGAGAATAAAAATAAAAATACGGAACCGAGGAATCACGTGAAACCGGTCCTGCTCATGTGATGTGAAAATGGCCGCTACGGGGG
-/CCGT ATGAGGCCGCGGCGATGGACAGCATCAGTAAAGCACCGGCTCCCCCGACAGAGCTCAACCTCACAGCCGAGCCCGAGAACAGCAGAGAGGCGACCACCAGCGACACGACAGAGAACCAGAAACCCAAAAGACCCAGTAATAACAGTGAGCTGCAATTGTAAACAACACTGTTTGTGTGCTAGTCACTGTGCATGTTAAGTTCTGCAGTGATTCTCTTTACGTTGCTGCTGTCGATAATGTTGTGTTTTTAACTAATGCAACTTGTTTCTGGATATATTTCTGTTATTCTGTTCTTGAAAGACGCATTTCGTGTATTGACTTTAAATATTTGTATATGGCAAGCCGTTTTAACAGTTAATCAATGAAACACAGCCTGCAAGTATTTTCATGCTACAGTTCACTCAAGCTTATTTCCTGCTTTTATCGGGGCCTGCCACAGCGAAATGAACTGCCAATTGTGGTTATGTTTTTTATGCAGTGGATGTAAGCGCCGGGACTTTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations