CRISPR

CRISPR1-bloc1s2

ID
ZDB-CRISPR-161219-1
Name
CRISPR1-bloc1s2
Previous Names
None
Target
Sequence
5' - AATGGCCGCTACGGGGGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ioz8 bloc1s2
zko3687A bloc1s2
Expression
Gene expression in Wild Types + CRISPR1-bloc1s2
No data available
Phenotype
Phenotype resulting from CRISPR1-bloc1s2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-bloc1s2
Phenotype Fish Conditions Figures
lymphoid progenitor cell differentiation increased occurrence, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
whole organism bloc1s2 expression decreased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
thymus lymphoid progenitor cell rag1 expression increased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
trunk hey2 expression increased amount, abnormal bloc1s2ioz8/ioz8 control Fig. 5 S3 with image from Zhou et al., 2016
trunk runx1 expression increased amount, abnormal bloc1s2ioz8/ioz8 control Fig. 5 S3 with image from Zhou et al., 2016
neuron bloc1s2 expression decreased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell myb expression increased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with imageFig. 5 S3 with image from Zhou et al., 2016
trunk runx1 expression amount, ameliorated bloc1s2ioz8/ioz8 chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor Fig. 5 S3 with image from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated bloc1s2ioz8/ioz8 chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor Fig. 5 S3 with image from Zhou et al., 2016
erythroid lineage cell gata1a expression decreased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
erythroid lineage cell myeloid progenitor cell differentiation decreased occurrence, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal bloc1s2ioz8/ioz8 control Fig. 5 S3 with image from Zhou et al., 2016
myeloid progenitor cell differentiation decreased occurrence, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell amount, ameliorated bloc1s2ioz8/ioz8 chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor Fig. 5 S3 with image from Zhou et al., 2016
myeloid cell spi1b expression decreased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell myb expression amount, ameliorated bloc1s2ioz8/ioz8 chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor Fig. 5 S3 with image from Zhou et al., 2016
trunk myb expression increased amount, abnormal bloc1s2ioz8/ioz8 control Fig. 5 S3 with image from Zhou et al., 2016
whole organism runx1 expression increased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
whole organism myb expression increased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
trunk hey2 expression amount, ameliorated bloc1s2ioz8/ioz8 chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor Fig. 5 S3 with image from Zhou et al., 2016
endothelial cell bloc1s2 expression decreased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with image from Zhou et al., 2016
trunk efnb2a expression amount, ameliorated bloc1s2ioz8/ioz8 chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor Fig. 5 S3 with image from Zhou et al., 2016
trunk efnb2a expression increased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 S3 with image from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression increased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 with imageFig. 5 S3 with image from Zhou et al., 2016
dorsal aorta hey2 expression increased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 S3 with image from Zhou et al., 2016
trunk myb expression amount, ameliorated bloc1s2ioz8/ioz8 chemical treatment: EC 3.4.23.46 (memapsin 2) inhibitor Fig. 5 S3 with image from Zhou et al., 2016
dorsal aorta efnb2a expression increased amount, abnormal bloc1s2ioz8/ioz8 standard conditions Fig. 5 S3 with image from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal bloc1s2ioz8/ioz8; jh11Tg; y1Tg standard conditions Fig. 5 S3 with image from Zhou et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal bloc1s2ioz8/ioz8; s896Tg; zf169Tg standard conditions Fig. 5 with image from Zhou et al., 2016
Citations