Genomic Feature

hu10012

ID
ZDB-ALT-160722-1
Name
hu10012
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Schulte-Merker
Current Source
Other Pages
Note
Frameshift mutation at amino acid 96, caused by an 11 bp deletion, resulting in a stop codon at amino acid 133
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 24: 1248760 - 1248770 (GRCz11) (1) Details
Nucleotide change
TGCCCACCAGC/-
Variant Notes
Frameshift mutation at amino acid 96, caused by an 11 bp deletion, resulting in  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
11 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation: at position 133 (1)
Sequences
Flanking Sequence
CCCCTACAATGTTTTGAATTTAGACTGCAATACCGGGTTCAACCACTAGGTAGGTCTCGATAATCAGGCATGCTTGCAAAATGTTGATGTTGTCAATCTGGCAACCTGTTTGTATGTCGAGTCATCATCAGAGGGTGCCATGTGAAAAATATACACACAATGATTTGAATTTGGACTGCAATACCTAGTTTAACCACTAGCTGTAAACCCTACTCTCTGCAAGCAGGGGCGCTGTTAGGGTTAGGACAATTCTAAAGGACCATGCTGTTTTGAGTGATACTATTAGGGGCCAACAGCAGCTTCCGGCTCATGACAGACTTAAATAGGGCTCCTTGGCCTCATAAAGTGGATGTTTGTAAATGTTTTTTCCTTACCCGTTTTGAAGATCTCATAGCGGATGGAGAATCCGGCACCGTGAGTCTCGTAGTCGGACACAAACTTGATGAAGAGCTGGTTTCCCGACGAGACCACCGGAGATGGAGCGATCTTTCCACAATATT
TGCCCACCAGC/- TGCCCGTTCTCATCCACGCCGTCTCTCACTTCCACATAGTCATATCTGCAGAGAGAGAAACACACACATGAACACACATTCATCTGAACATCTAACAATAACTAACACAATAACACTCAAAAATGTCCATAAAACAAATTGGCACTAATGTAAAGCACATTTTTAATCTGCAGTGTTTAAAATAAAGTGTAATATTTACTACTTTTGAGTACTTTTAGAAGGCCTAACTTCACTCATAATTTAAGTATTGCTTACAACAGATACTTTTACTGTACTTGCACATGCATAGTCATATCTGCAGAGAGAGAAACACACACAAACAGAACATCTAACACTGTCACAGCAGCTCAGCTGATTCAGATGAACAGTAAATGATATTTGGTTTGTTTATTTATTGCCACATAAGCAATATTTTGGCTACTTATGGCAAGATCAATATAAATAAAAATATATTACATAATAATAATAATAACAACTTCATAATACAATTGACCCTTTTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations