Genomic Feature

y58

ID
ZDB-ALT-160707-10
Name
y58
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Weinstein Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 44366577 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
early termination before the anticodon-binding domain of TARS
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Nonsynonymous, Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Glu>Stop at position 615 (1)
Sequences
Flanking Sequence
ATATCCAGATAAAGGATGCCATCGGCAGGTATCACCAATGTGCCACCATTCAGCTGGACTTCCAGCTGCCCATTCGCTTCAATCTCACATTTGTAAGGTGTGTTTACTCAGTGAAACATTACAGCCTGTGTACAATAATGAGTGTAATCAATAAATTTGAGTGCCTAAAGGAACATCCAGGGGCTTGATTTCAGTTCCTTGTACAACAGTGACATTTTGTGGTTCTATTTGATTACTGCACTGCAAGTTGTTGATCTTTAAAACCTCATCTCTCTTCAGTCATGATGGTGATGACAAGAAGAGACCAGTGATCATCCACAGAGCCATCCTGGGCTCAGTGGAACGGATGATCGCTATCCTGACAGAAAACTATGGAGGGAAATGGTACGGTTAATAGGAAGGCTCTCACATGATGATATTTATTCCTAACTCTGCTGTATGTTCGCATAAAACATACGCCTGATTTTATTTCCCACAGGCCACTTTGGTTGTCCCCGCGT
C/T AGGTGATGGTGGTTCCTATTGGACCCACCTGTGATGAATACGCTCAGAGAGTAAGTTTTGCTCACTATTCTTCAGACATTAGTAGCTGTTAGCTCTGATAATTTAGCTTAAGAAACATTTTGAATTATTGTCAGTGTTGTAAACAGATGTTATGATTGATATTTTAGTGTAAATTTTGTTTAAATTTATGTTGTATTCTTTAATGCATAGAAAATTCTAATGAAAAAGGTTACTTAAAATATAAATATTTAGTAGCATTGTTACAATTCCTTTACACTTGATCAGTTAAGTGCATTGTTGCTTATTAAATTTTAATTACATTAATTTATTTCACTTAAATTAAATAGTATTCCTAGTATAACTCCTTCTCCTTATTGTCATTGCTTTACAAAAGGTGCACTTTTTTATAGCTGATACTTATTTTATTAAACTTTTGACTGATTCTGATACCGATTTTTTTTTTTACACTTCCTCCCTTTTTTTTTTAAATAGATCAATAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations