ZFIN ID: ZDB-ALT-160511-1
Genomic Feature: bns1
Synonyms: bn1 (1)
Affected Genomic Regions: vegfaa (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-vegfaa
Lab Of Origin: Stainier Lab
Location: Chr 16: 4309248 - 4309257 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 10 bp deleted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: at position 113 (1)
FLANKING SEQUENCE (GENOMIC)
TATCTTAAAAGGCAGGTAATAAACCAATAGTTTTAGTAAGAACTGGTCCCCATACTGAAGTGTTACCAATTGTTATACAATGATTCGCCTAATTACCCTAACCTGCCTAATAAACCCAGTTAAGTCTTTAAATGTCACTTTAAGCTGGATACTAGTGTGTTGACAAATTTCTAGTCAAATATTATGTGCTGTCATCATGGCAAAGATAAAAAAAATAAGTTATTAGAAATGAGTTATTAAAACTATTATGTTTAGCAATGTGTTGAATAAAATCTTCATTTCATTAAACAGAAATTGGGGAAAAAATATACAGGAGGGCTAATAATTCTGACTTCATTTGTGTATATATATATATATGCACATGCTGGATTAAAGCTGTCTCACCTCCATAGTGACGTTTCGTGTCTCTGTCGGGACGCATTCGAGCGCCTCATCATTACAGCATCCTGCACAGCGCATGAGAACCACACAGGACGGGATGTACGTGTGCTCGATCTCAT
CGGGATACTC/-
CTGGATGATGTCTACCAGCAGCTCTCGGGTCTTGCACGCACTCTTTTTATACACATCCATGAAGGGAATCACTGAGGAGGAAGCAAAGCGAGAGTGTTCAGTTACCGTCACACCGTTCTCCCGTTCAACTAAAGTTCTCTCAATGTTAACTTACCTTTGTGTCATTCCAAACCTGTCTGCTGTTATTAATTATTTTCTTCTGTTAAACACAAAAAGAGAGTTTTACAGCGACTCTTTTCCATGCATGACTGTTCATTCATTATTAACCATGACTGAGTCTGTTACTGCTTCGAAAAGTCTTTACCCTTGTGGAAAAAAATGTGCTGAAAGGGGCAGTTCATCCAAAAATGAACATTTACTATTTACTCGACCTCAAGTGGATATAAACCATTTATGAGCTTCATTTTTATGTTGAACACAACAGAAGATATTTTAAAGGAGGATGAAAACCTGTCGACTTACATAATAGGAAAAGCACATCCAATGGAAGTCAATGGTTA
Comment Citation
p.Glu61Metfs*54 Rossi et al., 2016
10 bp deletion, resulting in frame shift beginning after glutamine Q60 and a  ... ZFIN Staff
OTHER bns1 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous vegfaabns1/bns1 vegfaa ♀+/- ♂+/-
Complex ci1Tg ; vegfaabns1/bns1 vegfaa
ci1Tg ; vegfabbns92/bns92 ; vegfaabns1/bns1 vegfaa, vegfab

CITATIONS  (8)