Genomic Feature

chi3

ID
ZDB-ALT-160314-2
Name
chi3
Synonyms
  • cd3 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Itoh Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 8: 53873726 - 53873733 (GRCz11) (1) Details
Nucleotide change
CTTCAATG/-
Variant Notes
This allele is the result of an 8 bp deletion in exon 6 of the mib2 gene,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Ile>Stop (1)
Sequences
Flanking Sequence
TCAGCAGTTTCTGAAATACTCAGAGCAGCCTGTCTGGCAGCAACAACCATGCCACGATCAGAGTCTCTTAAATCCCCTTTCTTCCCCATTCTGATGCTCAGTTTGAACTGCAGCAGATCCTCTTTACCATGTCTACATGCCGAAATGCAGTGAGCTGCTGCCATGTGATTGGCTGAGTAGACATTTGCGTTAACGAGCAGTTGGACAGGTGTACCTAATAAAGTGGCCGGTGAGTGTAAGCCATTATCATTCTGACACTGTTATTTTCATTGTCTGACAGTCGTGTAAACACTATCGTGGAGTTTTTCTCCTATTGTTTGAGTGCAAACAGTATATTTGTTGTACTCTCCCATTCACTGCACTCTAAGCTTACGAACTATAACGATTTCTGCAGCGAAGAAACACGCAAATCCGAAAAGTGTGTTATGCATCTCCATACTGTGTTAATACTCACCCGAAGGCCGTGTAGTGCAGCGCCGCGTCTCCGTCCTCATCTTTAG
CTTCAATG/- CTACTGTTAGCCTGTAGCAGGACCTTCACCACCTCTACATGACCCTGATGAGCTGCGACCTGCAGAGCCGTCTTTCCCTGGTTCTTAATGTCCACCTAAACACACACACACACACACACACACACACACACACACACACACACACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTCATTCATTCATTTATTCATTCATTCATTCATTTATTCATTCGTTCATTCATTTATTCATTCGTTCATTCATTTATTCATTCATTTAATCATTCATTTATTCATTCATTCAATCATTCATTCATTCATTCATTCATTTATTTATTCATTCATTCATTTATTCATTCATTCATTCATTCATTTATTCATTCATTCATTCATTTATTCATTCATTTATTCATTCATTCATTTATTCATTCATTTATTCATTAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations