Genomic Feature

s984

ID
ZDB-ALT-151020-1
Name
s984
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 8: 38053859 - 38053863 (GRCz11) (1) Details
Nucleotide change
GTGAG/AATAACGGTAATAAC
Variant Notes
Vanhollebeke et al (2015): TALEN designed to target sequences within exon 7,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
15 bp inserted / 5 bp deleted in Exon 7 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TAATTATTTATTTATTAAGTAGCAAAAACAATTTTCCAATATAATATGCTATTTTGTGTGGAGTTTGCATGTTCTCCCCTTGATGGCATTGGTTTGCTTCGTAAAACATATGCTGGATAAGTTGGTGTTTCATTCTGCTGTGGCACCCCTTAATAAATAAAATGATAAATTGTTGGGTTGCAGCAGGAAGGGCCTCTGCTGTGCTGCTCGATTAGTTGGTGGTTCATTTAGCGTTGGTGACTCCTGATGATTAAAAGAGACTAAGCTGAAAAGAAAATGAATTAATGTATATTACCAAACTGTTTCAATTCAATATAGTATGTGTTACCTTGTGATGAAGGTACAGTCATGTTGTACACTCTCCTCCAGATGAATTCCCTTGGTAGGGTCACTGGTAACAGGCTGACCATTTTGTCGCCAGTGAAGGGCAGTAATTTTGTCAACCAAAGAGGCAGTGCAATGGAAAGGCAGCCTGTCTCCCTTAAAAACAACCTGCCGCT
GTGAG/AATAACGGTAATAAC GGTAATAACGACAATGTGTGCAGTTCCAGTGGACCCTCTGAAAAGCAAAATTAATTGAAATATAAACATGAGAATCACAGAAAAAAAAAATATTACAAAGTCATGGCTTGTCTGCAGTTCCAACCTGTCTCCAATAAAGAATCTGTAGTGCATTTTGAAGTGCGATTTTCAGTTTCTCATATTCGTCAGCAGTTCAGCCTCAAATTGACACAGGTAATAAAAAAAATCTACTTAGCCATGTTCATCAAAATGTCCACTTTTGATTATATAAGACTTGTTTTCAATAGCGATTTTAAAACTTTTAATATAGGCTATTATAAATCAGAAAATGAGTGTACATAGTTTTACGTTAGGAAATGCAGTCTTAAATTTACAAACAGTCGGCAAGTACTAGAGAACGGATGTACACGCTCATGTCAAAGTAAAGCTCAACTTGCTTTGTTTTGCCTTCATTCATTTTTGTTTTCAGTAGTGACATAAAACACAAGTTTTTAAACACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations