Genomic Feature

zf549

ID
ZDB-ALT-150909-2
Name
zf549
Synonyms
  • atf d22 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
zinc finger nuclease 
Lab of Origin
Shavit Lab
Current Source
Other Pages
Note
predicted null allele, 22 bp deletion in exon 5 of the at3 genomic locus. Homozygous mutants survive into early adulthood, but eventually succumb to massive intracardiac thrombosis.
predicted null allele, 22 bp deletion in exon 5 of the at3 genomic locus. Homozygous mutants survive into early adulthood, but eventually succumb to massive intracardiac thrombosis.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 22: 16025433 - 16025454 (GRCz11) (1) Details
Nucleotide change
ATGGTGCTCATCTTACCCATTG/-
Variant Notes
predicted null allele, 22 bp deletion in exon 5 of the at3 genomic locus.  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
22 bp deleted in Exon 5 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
ACCTGCTACATACCAAGTATAGGTCTAGAGTGCCACTGTCCTGAGTTCCGCTATATCCCTAATCGAACAGACCTTAAAAAATAAAATGTTTTAGTGTTGCATGATAATTAAATGGCAGGTGTGATTGATTAGAGATGCCACTAAACTAATTATTATAGTGACCCCCAGGACTTGTCAACCCTTAAAAAATGTGGTTCTGAATGCAGCTCTAGAAATTTCCAGGCAGGTGTTTTAGAAGTAGAAAAGAGGTCCCTTAAGGTGTAGGATTTGGCATTCCTGACTCATGAACCCTGTTACAGTATGTTTTTTTCTTTGCATTCCAGGGGCAATGGAAAAACAAGTTTGATAAGCAAAATGTCATGAAGTTAGACTTTCATGTTAGCCCAACGCACAAATGTCCCGTCCCCATGATGTACCAAGAGAAGAAATTTCAATATGCAAAAATTCCTGAGGACAAAGTCAAGATCCTTGAATTACCCTACAACGGTGGGGACATCACA
ATGGTGCTCATCTTACCCATTG/- AAGGCGCAACCCTGTCGGAAGTAAGTCTACTATAAACAGTAAACACAATGTTCTCCTTTAAGATCTTAATCTGTCGCCATACATAACAATACTGAATCTATTTAAGGTGGTGGCAAATATGAACCTCAAGAAACTTGTCGGCTGGCTCCATGCTATGAAAGAGACCACAGTGGCTGTGCAGATTCCTCGTTTCCGTGTTGAGGACAGTTTCAGCCTCAAAGAGCAGCTGACGAAAATGGGCCTTGAAGATCTTTTTAGTCCAGCAAATGCCAGTCTCCCAGGTACATTACTCCGTTTTGACTTTAATGAATGTTTTAATTTTATGACTTCACCTGCTTTTTAAGTTACGATTAATTATGGTCAACGAATCTGGTGCACTCTGCTTGAAAAAGGCTTGACTTTAGCTATGTGTTCAAAACCACCTATAAGTGTACTTCTGAAGAGAAAGACTGGGACAAGGGCAGGTGGAGGGATGCTGGTAGAAACCGTCAGCTGAGACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations