Genomic Feature

hu5626

ID
ZDB-ALT-150818-1
Name
hu5626
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Schulte-Merker
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 19075465 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
Hermkens et al (2015): a guanine-to-adenine mutation leading to a predicted  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
at position 53 (1)
Sequences
Flanking Sequence
TTTTTGTCACCTCTGTTTTTTTCTTTTCTTCTGTCGTTGGTCTCAGGTTGCAGTCAAGGAGGAGCTGAAATCCTCCCGTGGGCCTGTGCTGGAAGCTGCTCCTCACATATAAAGCGCTTCCCAATGCCGGAGGAAACAGTGAATCACAGAGGGAGAGTCGAGCACCACACTCTCATCTCTCTCACTGAGCTCTTCAACCACCAGCTGCTCACTCAAACCCATCTTTTATTATTGCGCTTTTGACATTACTTTTCATTCAGAACCGAAAGAAAAACTATAGGTCGCCTCTGCGCCCGAGAAACAAAGTTTGAGTCAAAAGGAAGCCTAAGTTTTGACAGCGCACATGGCGGCTCTGATAAGTGCGTATTCGTCCTGGCCGGAGAGCTTTGAGTGCTCTGCGGGAAACGCGGACGTACCTGACGGACACACCTCTCACAGAGCTCCCGCGGACAAGGTGTCGGAGCCGCGCATCAGGAGACCCATGAACGCCTTCATGGTGT
G/A GGCCAAAGATGAGCGCAAGAGACTCGCAGTGCAGAACCCAGACCTCCACAATGCGGAGCTCAGCAAGATGCTTGGTAAGATTTTAACGTTGTGTTTTCTTTAATTATTAGTAATAATAGTGATGATGATGATAATAATAATAATAATTAATAATTGTTATAATGTTATTAATGTTAAGGGCAAGTTTTGTAAGACTTTAATCTTCCGTTACACAGCGCTTTCACTTTGTGCTTCGTAATTAAAGATTAAAATTAAATAAAATGTACAAATATTTTTTGTTTTGGAAGATTGAGTGGAATGATTTTTTTAAGCTACCTAAAATGAATATAACGTAAAAGAATGATGGAATAAATCTAAAGTAAGGATTGTTTTGTTTTTGGAATAAGAGCACGTAGGCTATACGATATTTCCTACTTTAAAAATTAAATACATAAAATGATAATAAGTAAAATACATTTTAAACACGTTTTTATACAGTTTAGAAATGCTATCATTATTTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations