Genomic Feature

st95

ID
ZDB-ALT-150504-7
Name
st95
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Talbot Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 18: 30568047 - 30568054 (GRCz11) (1) Details
Nucleotide change
GGCGGTCG/-
Variant Notes
Shiau et al (2015): 8 bp deletion, produces frameshift mutation just 3’  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
None
Sequences
Flanking Sequence
TAACTGACAATGGCGTGAACAAATCAAATTCCTGATAGTAATCAGTCAAATCTGCGTCAGAGGTCAATATATTTATTCATGCATCAGATTTATCTATATCTATTGGTGTATGAATACACATTGCCAAGTCCTTTAGCATATATTTCATAATCCTATTTATGGGATCTTCAGGAGAGTTCAGTAAATTGAGCTTAGGTATAAAGTGGATGAACCTGTAAAGTCCCCTTCCCCTCTTTTCCTTTCAGACAGATTTCTTGTAAATGCCTCCGTTTCGTGTAATCTCATTTACATATTCATGGTACGGCAACATAAGGCGTAGAGATTGGACGCCTTGGAGTTGCGCAAGCCAATCCGTTCTCACTACACTCTCCGTTCCCTTGCGCGGGTGTCTTTTAGATTATAAATAAAGCTGCTTGGATGCCGTGAGTATGTACTTTATAATCCTCAGCTGCTGTTTGTAACGGCATACTAGTGAAGTAAAGGTCTACAAGATGAACTCG
GGCGGTCG/- CAGACTGAAACAGTGGCTTATAGAACAGATAAACAGTAACATCTATAATGGACTGCAGTGGGAGGATGAGGACCGCACTATGTTTCGAATCCCCTGGAAACATGCGGGAAAACAAGATTACAATCAAGAGGTGGATGCGTCCATTTTCAAAGTAAGCGAAACATTATAGTAATAATAATAGTAGATTTAACAGTAACAATATGATTAAAAATAATGCAGCATTGCTATATTATTATTATTATTATTATTATTATTAATATTAATATTAATAATAAAAATAATAATAATATTAATAATAATATTATGGTTGTTATTGGAAAAAGTCAGATTTTTTCAGACTGTTATTAGATCATAGATCCCTGTGTACATGCAATTTGTCACAATCATAACATTTGAACTTAGTTATTTTCGATTTTGTCACAGTTTGATTGTATATTGTCTGTTTATTCTAATGTCTTCATTGCCAAATTATAACTTAATAATGCGTAAGGTATTGACTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations