Genomic Feature

gw326

ID
ZDB-ALT-150325-5
Name
gw326
Synonyms
  • skolios (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
sperm treated with ENU
Lab of Origin
Goldsmith Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 17: 48802719 (GRCz11) (1) Details
Nucleotide change
G/T
Variant Notes
Buchan et al (2014): nonsense mutation, caused by a G>T transversion at  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T at position 205 in RefSeq:NM_001077431 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Tyr>Stop at position 53 (1)
Sequences
Flanking Sequence
GGAAGGGCATCCGCTGCGTAAAAAACTTGCTGGATAAGTTGGTGGTTCATTCCACTGTGGCGACGCCGGATTAATAAAAGGACTAAGCCGGCAAGAAAATGAATGAGTTGTGGGATGTCTTTTGTATGAGTAAAGTAAACATGTGCTGCCTTCTTAAATCTTCACTTATGTTTAGGAAATGTCTCTATCATTGGCATTTAGACTTGTTAATCTGAGATTTGCCTTGCCAACTATAGCTGACAGGCCATGGAGACTCAAATTTTGCACTGAGAACATTTTAAATGGATTAAGTGTTTGTTAATTTGCAGAATCATGCTTTACTACATGTGCAATAAATGGAAACAAGAACCTATTTGTGTGTTGTGGATATCCAAATTTGATTTCAAATACATAACTAAAGAATAACGCCATATGCAATAATTACAAGCTTAAAGATATATTCATTATATTTTATTATCTCTCTCTCGCTCTATTTTTTTTTCTACACATTACCTGAATTT
G/T TAGTTTTCCCTCTTATTGTTGATAAAACCATCAGCCGCATCTCTGGGAACCAAAAACAGTAAACTACCGCCCTGCTCATCACAATCCGCAAAGTACTCCTGCAATAAGAATGCTTCAGCATGAGTACACTCATTTATTGAGGTAAAGTTGGCTTTATATTCACACATTCTGAGTTTCTCCTTAATAATATCATTTCAGAAAAGTTTATTTTGCAAATGATGAATAAAAAAATAATTTTAGCAACAAATGACTATCAAAGTACAACATTGTTTACAGTCAAACAAATAGTGCTAATGTTGTTCACAAGTCATACTTACATTTGATTTCAGAGCGAATAGTAGATAGTAAAGTTACCATGGCAAACCATATACGGAGCATGTCACAAGTTGTCACTGAACAAATGTGCGAATATAAACCCAACTTCACCTCAATCACTAATTTTAGAATTTGTAATCATGTAAGGTCACCTCTCTCTCTCGTTCTCTCTCTCTCTCTAATAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations