Genomic Feature

s987

ID
ZDB-ALT-150323-6
Name
s987
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
Sawamiphak et al (2014): c.266_273del of crfb17
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 1: 53850494 - 53850501 (GRCz11) (1) Details
Nucleotide change
CGGCTAAT/-
Variant Notes
Sawamiphak et al (2014): c.266_273del of crfb17
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted from position 266 to 273 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
ATGAGAGCCAGGAAAGAGAATGAGAGGACTGGGAAGAGTCACCTGAATATAATCCCTGTAAAAGCTTTTTATAAATATGTTGTTGTAATTATAAAGGTTTCAGAACTATTATACAATTGCTGAGGGTCATTTTCTGATGGAGTAGACCGTCCAGTCTGAGTTAATAGAAATTAATGTAATGAATGTAAGGTATCGGCAAAATCTAAAATCGTTCACTCTCTAAGCACCACCTGGCTCTGACTTTCACAGACATAAATGGCATTGTATTTCCTTTTTTTTGGTGTTGTTACTGCTTTGATTTCTTCTGTTGTCCTCATTTGTAAGTCGCTTTGAATAAAAGCGTCCGTCTGATTAAATGCAAATGATGAGCATTGTTTCATGAAGTATTATAAAAAATGTAATATACACAAAAATCAGGTGGTCATAAATAATGATCAAAGGCTAACATGGTTTTCTTTTCGTTTCAGCTGTGAGTCAGCCATCTTTTAGTCATCCTTCTC
CGGCTAAT/- TTGTCTATTCTCTGCGACAACTATGGAGTTGAAATACGATGGGACTATCCTGACACCAGACACGGTGTGAGCTTCCAGGTGGAGGTCAATGATCAACTCAAACAGAGGTAAATCATCATGTTTAAATGCTCGTTTTAGTCCTGACAGCCGATTTGAATGATATCACTTTATTGAATTGGAGTTATCAGTGGTTATCAGCTGATGGGCCACTAGGGTAGGCTACTGGTAGGCTCAGAAGGCTGTTATCATCCATCTACATGGTTAATCAGCTATAGATCACATACAGCTGCGGCTGTTAACGAGATTAATTTATATTATTTATAAAACTTCCCATTAATTGTATTGTATTAACATCTAACCCTAAACCCAACCATCACAGTTCTGGATCTGGAGTTTTCTTTATTAGTATAGTTGATTAACCACAAAATTCTTTAATATTATTTATTAAATTTTCCATTAATTGTATTTTATTAACGTCTGCCCCTACTCCAACTCTAAAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations