ZFIN ID: ZDB-ALT-150323-6
Genomic Feature: s987
Synonyms:
Affected Genomic Regions: ifngr1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-ifngr1
Lab Of Origin: Stainier Lab
Location: Chr 1: 53850494 - 53850501 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 8 bp deleted from position 266 to 273 (1)
FLANKING SEQUENCE (GENOMIC)
ATGAGAGCCAGGAAAGAGAATGAGAGGACTGGGAAGAGTCACCTGAATATAATCCCTGTAAAAGCTTTTTATAAATATGTTGTTGTAATTATAAAGGTTTCAGAACTATTATACAATTGCTGAGGGTCATTTTCTGATGGAGTAGACCGTCCAGTCTGAGTTAATAGAAATTAATGTAATGAATGTAAGGTATCGGCAAAATCTAAAATCGTTCACTCTCTAAGCACCACCTGGCTCTGACTTTCACAGACATAAATGGCATTGTATTTCCTTTTTTTTGGTGTTGTTACTGCTTTGATTTCTTCTGTTGTCCTCATTTGTAAGTCGCTTTGAATAAAAGCGTCCGTCTGATTAAATGCAAATGATGAGCATTGTTTCATGAAGTATTATAAAAAATGTAATATACACAAAAATCAGGTGGTCATAAATAATGATCAAAGGCTAACATGGTTTTCTTTTCGTTTCAGCTGTGAGTCAGCCATCTTTTAGTCATCCTTCTC
CGGCTAAT/-
TTGTCTATTCTCTGCGACAACTATGGAGTTGAAATACGATGGGACTATCCTGACACCAGACACGGTGTGAGCTTCCAGGTGGAGGTCAATGATCAACTCAAACAGAGGTAAATCATCATGTTTAAATGCTCGTTTTAGTCCTGACAGCCGATTTGAATGATATCACTTTATTGAATTGGAGTTATCAGTGGTTATCAGCTGATGGGCCACTAGGGTAGGCTACTGGTAGGCTCAGAAGGCTGTTATCATCCATCTACATGGTTAATCAGCTATAGATCACATACAGCTGCGGCTGTTAACGAGATTAATTTATATTATTTATAAAACTTCCCATTAATTGTATTGTATTAACATCTAACCCTAAACCCAACCATCACAGTTCTGGATCTGGAGTTTTCTTTATTAGTATAGTTGATTAACCACAAAATTCTTTAATATTATTTATTAAATTTTCCATTAATTGTATTTTATTAACGTCTGCCCCTACTCCAACTCTAAAC
Comment Citation
Sawamiphak et al (2014): c.266_273del of crfb17 Sawamiphak et al., 2014
OTHER s987 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ifngr1s987/s987 ifngr1 ♀+/- ♂+/-
Complex ifngr1s987/s987; la2Tg; s896Tg ifngr1

CITATIONS  (3)