ZFIN ID: ZDB-ALT-150323-5
Genomic Feature: s986
Synonyms:
Affected Genomic Regions: ifngr1 (1)
Type: Indel (1)
Protocol: embryos treated with TALEN1-ifngr1
Lab Of Origin: Stainier Lab
Location: Chr 1: 53850494 - 53850502 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 2 bp inserted / 9 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
ATGAGAGCCAGGAAAGAGAATGAGAGGACTGGGAAGAGTCACCTGAATATAATCCCTGTAAAAGCTTTTTATAAATATGTTGTTGTAATTATAAAGGTTTCAGAACTATTATACAATTGCTGAGGGTCATTTTCTGATGGAGTAGACCGTCCAGTCTGAGTTAATAGAAATTAATGTAATGAATGTAAGGTATCGGCAAAATCTAAAATCGTTCACTCTCTAAGCACCACCTGGCTCTGACTTTCACAGACATAAATGGCATTGTATTTCCTTTTTTTTGGTGTTGTTACTGCTTTGATTTCTTCTGTTGTCCTCATTTGTAAGTCGCTTTGAATAAAAGCGTCCGTCTGATTAAATGCAAATGATGAGCATTGTTTCATGAAGTATTATAAAAAATGTAATATACACAAAAATCAGGTGGTCATAAATAATGATCAAAGGCTAACATGGTTTTCTTTTCGTTTCAGCTGTGAGTCAGCCATCTTTTAGTCATCCTTCTC
CGGCTAATT/TC
TGTCTATTCTCTGCGACAACTATGGAGTTGAAATACGATGGGACTATCCTGACACCAGACACGGTGTGAGCTTCCAGGTGGAGGTCAATGATCAACTCAAACAGAGGTAAATCATCATGTTTAAATGCTCGTTTTAGTCCTGACAGCCGATTTGAATGATATCACTTTATTGAATTGGAGTTATCAGTGGTTATCAGCTGATGGGCCACTAGGGTAGGCTACTGGTAGGCTCAGAAGGCTGTTATCATCCATCTACATGGTTAATCAGCTATAGATCACATACAGCTGCGGCTGTTAACGAGATTAATTTATATTATTTATAAAACTTCCCATTAATTGTATTGTATTAACATCTAACCCTAAACCCAACCATCACAGTTCTGGATCTGGAGTTTTCTTTATTAGTATAGTTGATTAACCACAAAATTCTTTAATATTATTTATTAAATTTTCCATTAATTGTATTTTATTAACGTCTGCCCCTACTCCAACTCTAAACC
Comment Citation
Sawamiphak et al (2014): c.[266_272del; 274T>C] of crfb17 Sawamiphak et al., 2014
OTHER s986 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ifngr1s986/s986 ifngr1 ♀+/- ♂+/-
Complex ifngr1s986/s986; la2Tg; s896Tg ifngr1

CITATIONS  (3)