Genomic Feature

s986

ID
ZDB-ALT-150323-5
Name
s986
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
Sawamiphak et al (2014): c.[266_272del; 274T>C] of crfb17
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 1: 53850494 - 53850502 (GRCz11) (1) Details
Nucleotide change
CGGCTAATT/TC
Variant Notes
Sawamiphak et al (2014): c.[266_272del; 274T>C] of crfb17
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp inserted / 9 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
ATGAGAGCCAGGAAAGAGAATGAGAGGACTGGGAAGAGTCACCTGAATATAATCCCTGTAAAAGCTTTTTATAAATATGTTGTTGTAATTATAAAGGTTTCAGAACTATTATACAATTGCTGAGGGTCATTTTCTGATGGAGTAGACCGTCCAGTCTGAGTTAATAGAAATTAATGTAATGAATGTAAGGTATCGGCAAAATCTAAAATCGTTCACTCTCTAAGCACCACCTGGCTCTGACTTTCACAGACATAAATGGCATTGTATTTCCTTTTTTTTGGTGTTGTTACTGCTTTGATTTCTTCTGTTGTCCTCATTTGTAAGTCGCTTTGAATAAAAGCGTCCGTCTGATTAAATGCAAATGATGAGCATTGTTTCATGAAGTATTATAAAAAATGTAATATACACAAAAATCAGGTGGTCATAAATAATGATCAAAGGCTAACATGGTTTTCTTTTCGTTTCAGCTGTGAGTCAGCCATCTTTTAGTCATCCTTCTC
CGGCTAATT/TC TGTCTATTCTCTGCGACAACTATGGAGTTGAAATACGATGGGACTATCCTGACACCAGACACGGTGTGAGCTTCCAGGTGGAGGTCAATGATCAACTCAAACAGAGGTAAATCATCATGTTTAAATGCTCGTTTTAGTCCTGACAGCCGATTTGAATGATATCACTTTATTGAATTGGAGTTATCAGTGGTTATCAGCTGATGGGCCACTAGGGTAGGCTACTGGTAGGCTCAGAAGGCTGTTATCATCCATCTACATGGTTAATCAGCTATAGATCACATACAGCTGCGGCTGTTAACGAGATTAATTTATATTATTTATAAAACTTCCCATTAATTGTATTGTATTAACATCTAACCCTAAACCCAACCATCACAGTTCTGGATCTGGAGTTTTCTTTATTAGTATAGTTGATTAACCACAAAATTCTTTAATATTATTTATTAAATTTTCCATTAATTGTATTTTATTAACGTCTGCCCCTACTCCAACTCTAAACC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations