ZFIN ID: ZDB-ALT-141007-4
Genomic Feature: uw8
Synonyms:
Affected Genomic Regions: clstn1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-clstn1
Lab Of Origin: Halloran Lab
Location: Chr 23: 29630691 - 29630700 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 10 bp deleted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TTATTTAAAGTAATAAAGTTTAATATTATTATTATTATTATTATTATTATTTGTGATAATATCACTGTTGCAAAGAAGACAGTCTCAGAAAATAAATAACTTAATTTTTTTATTCTCATTTTAAGATATTACCAGTTTTGAAAAAATATAATAAATCATATAAATAGTAATCGAAGGCACAAAATATAACTGTCTGCTTTTATTTATTTATTTATTTGTTAGTTTCTTCGGTTGTTTGTTTTAAATCTTGACAGTTACAATACAAACAATATGAACCTACAAGACATTCGTTATCAAAATAATTAACTAAATAAAAATCTCATGAAAAAAACAACACCACAACTTTCATTGATTTATGTGAATACCCCTTTAAGTTTCAGAAAGCATGAGGAAGCAAAATGGCTGCCATTCGAGACCAGAAGATGGAGGATCTTACCTGCGTAGCGCAAAGGAGCATCTTTATCCAAGGCTATCAGAGGAGGGTCCAGCAGAACTTTGTC
GTCGTTTTCT/-
GTCACGATACCATGATACGTGGTCTCAATCCACGGCTTGTGCTTATTTACTGTGAAGGTGAAAAAAAAAACAAGACAGAGAGAACTTTTGTTTAGACGCCAAATAAAACCAAGGCCAGACAACAACCAATTATTTTGTATTTCTCTGAGGATGCACTATGTGTCAGCACAACCGTCCGCCAGCTTAAAGGCAGAATCGCAGGCTGGCGTAACACAGCGGTGGTGAGTGTGTGTGTGGTGGCATTTACTTCTCTCAGCAGCTCATTAGTGTTGACTGAAGGCTTTGAGCTCTGAAAGTGGAGAGGACAGATGTGCTGCACAATCACTGCAGCTAGTTTAACCCGGTTTACTCAAGATAATTGACAAGGGAATAGGAAAGCTGTGTCATACAATCGTTACTACATTATTAAAACAAGAGTCCAGAAGAAAATGGCTCAAAATAATGAAAACACTTGTGAAACACCCCAATACCCTTATCTATCAATTAAAGCTAGCTTTTTC
NOTES
Comment Citation
Allele clstn1 uw8 has a 10 nucleotide deletion that would result in a frame  ... Ponomareva et al., 2014
OTHER uw8 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous clstn1uw8/uw8 (AB) clstn1 ♀+/- ♂+/-

CITATIONS  (2)