Genomic Feature

i276

ID
ZDB-ALT-140717-4
Name
i276
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Ingham Singapore Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 9: 37272481 - 37272482 (GRCz11) (1) Details
Nucleotide change
-/CTGT
Variant Notes
Wang 2013: 4-bp insertion in gli2a which causes a frame shift resulting in a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp inserted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GACGGGATTGTGAATGCTGAAAAGTGCAGATAGGTTTTAATTCGTTATGTAATTCTTACTAGAAAGAACCTAATTTGTAATTGTTTTATTTTTCAGCATGATAATCCCTAACACACTGTTAATGTAATGAAATAATATGTGGAGAGAAAAACATCATGAAATGGCCTCCACAGTGTCCAGACCTAAATATTATATACAATATGTATATGCAATATCACAGGCAGTATGCCATTCTCCTGGAGAGAAAACATAAAGTTAGATTATGCTAAATCTAAGGAAGAACTTTTAGAAATTTTATACAATATGCATACAATATTGTTTATACACAAAGAAACCTAAATATTAGCATTGGCTATCAGCCATATTGGGTTATTGCGAAAAAAAAAAAGTATTCAGGTTCCCTATAACTTAAACAAGCTAACGCCTTTTCTCTTTTTTACCATTCCAGTCCATCCTTCACGTTCCCACACCCCATCACACCGGTTGCATACCACCAGCTGT
-/CTGT TGTCCCAGCAGAGGGGTCTGAATGCATTTGGACACACTCCTCCTCTGCTGCAGCCTTCACCTGCCCTCAGCAGCAGACAGCAGACACTCGTGGCTGCAGCCGCTCTCAACAACACCACCAGCAGCAGCACCAGCAGCAGCACTGCAGACACCAGCACCGAGTCCAGCCAGGTGATTATTACAGCATTACTGATGTGGCGTTTAAAGTAAAATCTTTCATTCACTGAGAATGTACAGTGCTTGGCATAAATGTGTACACCCCTCACAAAGCTCTGTACACTATAACATGTTTGGGTATATACATTAGATTAGTCAGTACCAAATCAAAAACTAGATCTAATTTAATGAAATAACTGTAAAAAGTACACCCAAATTAATATGAAAAAATATTAAATACATTTTTTTTTACTTTGTTTTTAATGATTTTTTTTAGAAACATATGACCAGTGGGAACAAAAAAAAAATAATAATAATAAATAATAATACATAGATATATAGGCAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations