Genomic Feature

i275

ID
ZDB-ALT-140717-3
Name
i275
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Ingham Singapore Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 9: 37272474 - 37272485 (GRCz11) (1) Details
Nucleotide change
CCAGCTGTTGTC/-
Variant Notes
Wang 2013: 12-bp deletion the deletion in gli2a gene results in the loss of  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
12 bp deleted (1)
Transcript Consequence
None
Protein Consequence
Amino Acid Deletion: 4 AA missing from position 283 to 286 (1)
Sequences
Flanking Sequence
GGGATTTGACGGGATTGTGAATGCTGAAAAGTGCAGATAGGTTTTAATTCGTTATGTAATTCTTACTAGAAAGAACCTAATTTGTAATTGTTTTATTTTTCAGCATGATAATCCCTAACACACTGTTAATGTAATGAAATAATATGTGGAGAGAAAAACATCATGAAATGGCCTCCACAGTGTCCAGACCTAAATATTATATACAATATGTATATGCAATATCACAGGCAGTATGCCATTCTCCTGGAGAGAAAACATAAAGTTAGATTATGCTAAATCTAAGGAAGAACTTTTAGAAATTTTATACAATATGCATACAATATTGTTTATACACAAAGAAACCTAAATATTAGCATTGGCTATCAGCCATATTGGGTTATTGCGAAAAAAAAAAAGTATTCAGGTTCCCTATAACTTAAACAAGCTAACGCCTTTTCTCTTTTTTACCATTCCAGTCCATCCTTCACGTTCCCACACCCCATCACACCGGTTGCATACCA
CCAGCTGTTGTC/- CCAGCAGAGGGGTCTGAATGCATTTGGACACACTCCTCCTCTGCTGCAGCCTTCACCTGCCCTCAGCAGCAGACAGCAGACACTCGTGGCTGCAGCCGCTCTCAACAACACCACCAGCAGCAGCACCAGCAGCAGCACTGCAGACACCAGCACCGAGTCCAGCCAGGTGATTATTACAGCATTACTGATGTGGCGTTTAAAGTAAAATCTTTCATTCACTGAGAATGTACAGTGCTTGGCATAAATGTGTACACCCCTCACAAAGCTCTGTACACTATAACATGTTTGGGTATATACATTAGATTAGTCAGTACCAAATCAAAAACTAGATCTAATTTAATGAAATAACTGTAAAAAGTACACCCAAATTAATATGAAAAAATATTAAATACATTTTTTTTTACTTTGTTTTTAATGATTTTTTTTAGAAACATATGACCAGTGGGAACAAAAAAAAAATAATAATAATAAATAATAATACATAGATATATAGGCAAATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations