ZFIN ID: ZDB-ALT-140514-1
Genomic Feature: sh397
Synonyms: Y431* (1)
Affected Genomic Regions: pink1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Bandmann Lab
Location: Chr 23: 37476548 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G at position 1405 in RefSeq:NM_001008628 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Tyr>Stop at position 431 (1)
FLANKING SEQUENCE (GENOMIC)
GTTAACTAGGCAAGTTAGGTTAATTAGGCTAGCTATAATTAGGATACCTGGATGCCTACCTAGGAAGGTGTTCCAGGGATGTCTCACAGGGAGGGGTCTCTGGAAAGACCCAGGAAACACTGGAGGGACTATGTCTCTCGTCTGACCTAAGAGCACCTTGGGATCCCCCCCGGACGAGCTGGAGGAAAAGGGAAGTCTGGGGTTCTCTCCTGAGACTACCTCCCCACAACCCGGCCCTTGAAAAGTGGATAAAAATGAATAATATCGACCTTAGCAGTTAACAACCTTAGCATTTAGCAACCTTATATATATCCATAAGAAAAATATAATAGTCTTGCTCTGATGAAACATCCCTATGCAAATTTGAAAATGTAATTTATTCAGAGATGAAGTGCATTGATGACTGATGATCTCCTATAGGTGTCCATGGCAGTGCCTGGTCCAGGGGTGGTGATTGATTACAGTAAAGCAGATGTGTGGGCTGTGGGAGCAATTGCTTA
T/G
GAGCTCTTCGGTCAGCCAAACCCCTTCTACACACTGGAGAGTCGGAGTTACCAGGAAAAACAACTGCCTGCACTTCCTGCTGCTGCGCCTGATGACGTTCAGCTGGTGGTGAAGCTGCTGCTGCGCGAAAACCCTCATAAGGTACAGCATTTACCTGCAAACACCACCATGTTCATTTAGCCAATGTGTTTATAGCAGCTGTTTTACTTTGTGATATTAAGGTGATAATATTTTGCTGGGAAAATAGCAAATTGGCCTAGAAATAGTTTTATTTTCGTTTTATTTAATTGGGGATTACTTGTAGTTCTTTAACTATTTTTATTCAAAACATAGGTGTTATATAAATAGGCTCTCGACAATATTTGCGGTATAAATCTATACATTTTTCATTTATGTATTTTTATTAATTTATTTTAAACATAATTTTTTATTAAATTGTTTATCCTTTAATTTTTTATATAGTTTATTTAATTATTTATATAATCATTTTATTATTTACA
Comment Citation
A T to G change at position 1405 in NM_001008628 results in a change from  ... ZFIN Staff
OTHER sh397 PAGES No links to external sites

CITATIONS  (6)