Genomic Feature

sh397

ID
ZDB-ALT-140514-1
Name
sh397
Synonyms
  • Y431* (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Bandmann Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 23: 37476548 (GRCz11) (1) Details
Nucleotide change
T/G
Variant Notes
A T to G change at position 1405 in NM_001008628 results in a change from  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>G at position 1405 in RefSeq:NM_001008628 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Tyr>Stop at position 431 (1)
Sequences
Flanking Sequence
GTTAACTAGGCAAGTTAGGTTAATTAGGCTAGCTATAATTAGGATACCTGGATGCCTACCTAGGAAGGTGTTCCAGGGATGTCTCACAGGGAGGGGTCTCTGGAAAGACCCAGGAAACACTGGAGGGACTATGTCTCTCGTCTGACCTAAGAGCACCTTGGGATCCCCCCCGGACGAGCTGGAGGAAAAGGGAAGTCTGGGGTTCTCTCCTGAGACTACCTCCCCACAACCCGGCCCTTGAAAAGTGGATAAAAATGAATAATATCGACCTTAGCAGTTAACAACCTTAGCATTTAGCAACCTTATATATATCCATAAGAAAAATATAATAGTCTTGCTCTGATGAAACATCCCTATGCAAATTTGAAAATGTAATTTATTCAGAGATGAAGTGCATTGATGACTGATGATCTCCTATAGGTGTCCATGGCAGTGCCTGGTCCAGGGGTGGTGATTGATTACAGTAAAGCAGATGTGTGGGCTGTGGGAGCAATTGCTTA
T/G GAGCTCTTCGGTCAGCCAAACCCCTTCTACACACTGGAGAGTCGGAGTTACCAGGAAAAACAACTGCCTGCACTTCCTGCTGCTGCGCCTGATGACGTTCAGCTGGTGGTGAAGCTGCTGCTGCGCGAAAACCCTCATAAGGTACAGCATTTACCTGCAAACACCACCATGTTCATTTAGCCAATGTGTTTATAGCAGCTGTTTTACTTTGTGATATTAAGGTGATAATATTTTGCTGGGAAAATAGCAAATTGGCCTAGAAATAGTTTTATTTTCGTTTTATTTAATTGGGGATTACTTGTAGTTCTTTAACTATTTTTATTCAAAACATAGGTGTTATATAAATAGGCTCTCGACAATATTTGCGGTATAAATCTATACATTTTTCATTTATGTATTTTTATTAATTTATTTTAAACATAATTTTTTATTAAATTGTTTATCCTTTAATTTTTTATATAGTTTATTTAATTATTTATATAATCATTTTATTATTTACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations