Genomic Feature

hg16

ID
ZDB-ALT-140415-5
Name
hg16
Synonyms
  • L124P (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Sood Lab
Current Source
Other Pages
Notes
Comment Citation
hypomorphic allele Rissone et al., 2019
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 19: 35422394 (GRCz11) (1) Details
Nucleotide change
A/G
Variant Notes
Point mutation in exon 4, cDNA: T371C; p:L124P ; T371C/L124P missense  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C at position 371 in Exon 4 (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Leu>Pro at position 124 (1)
Sequences
Flanking Sequence
GTTTATGTGTTGAACTCAGATATACAGCGCAATATAGAAAATATTTTGCCACCGATGTTGTATTGCCATTTCAAACAAGAATATCATTTCCATGCTTTACAGTTCCTACCAAAAGGAAGACCTAGATTACAGATCTTCTCTTTACTCATTCTCCACCTAATTTTTCACCTTCTGTTAAACCCAAAAGGTATTTTGAAGAAGGCTGGAAACAGGTAGCCATTGACTTTCACTGTATTGCTTTAATGTATTGAGGAATGTCAATGACTCTCAGTTTCTAATATTCTTCAGAATATCTTCTTTTGTGTTCAACAGATAAACTCACATATTTGCATGGTTTTGGGTGAACCATCTCATGAACAATGAAGATTTTAGAAAGGTGGTTTTTAGGTGATAGCTTCTAATCCAATGGTCCACACTTACAGGACCCTCCATGCTCTTACCTTCCACAGATCCTGCGGACTAGCAGGGAGTCATCGACAGAGAACTCAATAACAGAGTCC
A/G GTTTCTCACTACGCTTCTCCATGAGGTCATCCAGCTACAAATGAGAAACAGCAAAAAATTGTAAATTAACCCTTGTGTACTGTTCAAATTGACTACCCTTTCTTTAGCCCCTTTCACACAGTGATACCGGTAAATTTCTGGAAAATTTCCGGAACGACTTTACCGGTATATTCAAAAAAGCGCTGTTCACACAGGCGAGGACGTTACGGAAATTTTCCGGAAAAGAGCATTCACACATCCATTCCAAAATACCGGTAAATTCTGACATCATTCACCACAAATGAGCTTTAAACGGCTGCGCTTGCATTTGTAAACATTTGACTAAATTACAAACTCTGTGGATGATCAATATTGTGAACAACTTTCGCAGGATCACTTTCGCATGTCGAGATGTTCATAATATGTGCGTGTGCAGGCGCTCATAGGCGCACGCAAAGCTTGAAGGTAAACAAACAACGGCTTGTCTTAAGCATCTCATCGATGATTATTTACACAGTTGG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations