Genomic Feature

hg15

ID
ZDB-ALT-140415-4
Name
hg15
Synonyms
  • ins4 (1)
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Sood Lab
Current Source
Other Pages
Notes
Comment Citation
more likely fully null allele Rissone et al., 2019
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 19: 35428774 - 35428775 (GRCz11) (1) Details
Nucleotide change
-/CCGT
Variant Notes
Insertion of 4bp in exon 1, cDNA: 41insACGG; p:K16TfsX64
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp inserted at position 41 in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
AGAACTGGAAATAAATACAATGTGTAACGTTACATGACGACAGAACTTGACGTTAACGTTACATATCATAACTGACATTACTGAGTGAGCTAACGTGTCATTCCCAGGAAAACAGTGAGGTAAATTTGGTTTTATATTCACACATTTAGACTTTAAAATATACTTTCTGAATGTATCAATTGCAAATTCTAAATAGTAAAATCATATTAACATTGTATTTGACTATCAAAGCACAACAATGTTCAGTCAGTAAAATAAGGCTAATGTTGTTTTGAAGTCATACTTGCATATGATTTCAGACCGAATATTCAAAGTAACATTACTATGGTAAACACTGTATAGAGCATATCACTGAACTGAATATAAAACCAACTTCACCTCAATAACCCAGAGCACTATCCCGCTTCAGAATGAGCCACGCGGCCCTTTGGATAAACTCTCACCTGCGTTCCCTTCCCCGCGCCGGGCGGCCCGAGCAGAATGGCCCGTATGCCTTTCCGT
-/CCGT ATACCGGAGACGGTATCGTCCTCTTGTGTGCTAGGGGCCATGGCTACAGCTTCTTTACTAACTAAACACACTTCTCTCCACTACACACTTTGCGTCCACTAACTCTCTCAGCCTAGAAAGGAAGTGGTAACGCCTCCGTTTGCTGAGTATGGACTCAAAACCCCGCCTTCTCTCACCAAACTAATGATCTGATTAGCCAAAGGCACGCCATTCACACAGAACGCAAGCTCATTGGATGAAATCGAATGCCTCAGTATCACATAGCATCCGGATTTTGGCCTAGAATGACACATCGCACTGGAGGATCAAGATGAGCAGGTTTATATCACAGAGCTTTAGATAAGGCGGAATGAGATATCCGTATCTAAAACGACACCTTAATGGCTATATCAGAATGTTCAAAGGTCGTTATTACGCGTTTGTTCTTCCGACTTAATTGATAACTTTATATTAACCACAGATCATAATTTGGAGGTCTTTTAACATTTTAAAACCTTTCAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations